Description :
From Genome Similarity Track
Location :
Scaffold_249:21341- 26060
Transcript NameFunction/comments
Physo_144723hypothetical protein

Sequence
4719 bases(100 bases per row)
AGGCCCGACTCAAAGCGCTTCGAAACGCCAAGAACTTCATCTACATCGAGGACCAGTACTTCATCTACGTGCCCGAACTGCTGGACGCTCTCATGGAGGT
CTTGCCCCGGATCCAGCGCCTCATCGTGCTCGTGCAGCCGCCCGACACGCTGCTCAAGGCCTCAGGCTACGAGAAGTACCTGTACGAGATGATCGGCCCC
ATGAAGGAGAAATACCCCAACAAGGTACAGATTTACACCACCAAGCCAGAATTGGACATCTACATCCACACCAAGCTCGTGCTCATCGACGACGTGTACG
TGTCGCTGGGCTCGGCCAACTGGAACCGCCGCAGCATGACGTCCGACTCGGAGCTCAACGCCAACGTCATCGACGACGAGACGGTCGAGTCGCCTGACGG
CGTCACGGTGCTCAAGCTGGCGCGCGACATGCGCATCCGCAAGTTCGTCGAGATGACGAGGCTCAGCTACAAGAAGCTCAACGCCATGAAGTTCATCGAT
GCGGCGGACCAGTTCAAGATTGCCGCCAAGGACGAGTCCACGATCCTCACGGACTTCAGCGTCAAGCACCACGCGTACTACATCACGTTCGTCGACGTAT
TCCGGGAGCAGGTCGATCCGCAGGAGGTTTGCACCTTCACGGAGGAAGGCTCCAAGAGAGAGATTCAGTAGTGTGGCGCAGTGCAGTGAACTCATTTTTT
TTAAAACTACGAGCCGCTAATTATCTCGTAAGTAGAAGCCTTTGGATTACCCCGCAACTTCTTAGTTAGGATTTTCGTTAAAGACGTTCGACTGCTTGAC
TTCTCAGCGCAGCTGTAGCACTAGCAAGAGTTTACATGGCCGATGATCGGCCTATGAAATCAAATAGGCAACCCGGAGCGTTGCTCCGGGAGGGTACACA
GGTCGACGAATAGTTTCATGGACGATGATAACGGTTAATATTTGAGTAAATCCCAAAGTTGTATTGTTTTTAATCCTTTAAAAAGGCACTACCAGCCCAG
CTCTTTAGTAGACTCTAACGTGGGCATCTACTGTGGCTCTCCTGAAGAACAGGCCCGCTTTTTAGAACGTTCTAAATCTAGAACAGAAAATGACTTGAAC
TTAATACGGATGCTGTCCTTGTTTTGCCCTATGAGATGCTCATGATAGGCCCGCTTTTGACCGGCTTTCGCCAGACCTCCAAAGCGTAATCACTTAACCC
CTTGGACGCGGAGGGTTGGAAATTCACCTTATGCTGTTCTGAACAGCATAAGAATCACTTAATGTCACTATACCTCTAAATCCGCAAAAAGTGATTATCG
TCCCTTCCCATATCTAGCTTGGATATCATTGGTCCACGTATCCAAACGTGGCCATTTGATTGGGCATCAATAACATATGACTATCAGGCTAGTTCAACTA
CCACGCACAAGCACGAACTATTTTTCAGAAAAAATCAAACATCGGTCCCCTCTGCTGCCGCCACTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTATTTGTCAGTCATCTTGTCGCTACTAATGCGCGATCTTTCATCCCTACCTGAAAGGTCACACAAATACATATAGCTCTTTATAT
GCTGCATAAATAACGGTAAGAAACATCACAGAGGCGCCAGGCAACGCCAACTTTGAGGATAAATCGCTCGAGATCTACATACATTTAGCGCTTCATACAG
CGGCATTACCCAAACTAGATGCAGGGCTTTCTATCCATGTCGGTCTCAACGGCGATGTTCCTCTTATTGAAGAGTTAAATTCGCCGAAATCACAGGTTTC
CGACCTGTCATGTGCATTCGTGAAGGGACGCTCAGTTAATTCTGATACTTGCTTTCTATACGAAAGTATTGTATAACCGATAGTTATACCAGACCTCCAG
TAGGGCCAGTAATACTACTACCTTGATTTGGTCGATTATCCTAACCTCTGGTCACCCCTCCAGACGAAGTACCCGAACAAGTTTCGAGTCTACACCACCA
AGCTCGAGCGCGATATCTACACCCACAGCAAGTTCGTCATCATCGACGACGTGTACCTGTCCGTGGGCTCGGCCAACTCGAACCGACGCAGCATGACGTC
CGATTCGGAGCTCAACGCCAACGTCGTGGATGACGAGACCGTTGAGTCGCCGATGGCATTACAGTCAACAAACTCGTGCGTGACTTCCGCATCCGCAAGT
TCGTCGAGATGACGGGACTGAGCTACGACAAGCTGGATGCCATGACGTTTCTCGACGCCGCGCACCAGTACGACGTCGCCGCCGCGGACACTTCGTCCCT
CATCCAGACCCTAGAGGCC