Description :
From Genome Similarity Track
Location :
scaffold_335:2134- 6589
Transcript NameFunction/comments
g7391.t1 hypothetical protein PHYSODRAFT_558658

Sequence
4455 bases(100 bases per row)
GGATGCGCTCGGCCAGATAAAAGGCCGGGTTCGCGATGACCGAGAAGGCGATAGTAATGTGCAGCTGCATGAACAGGTAGGCCAGCACAATGACACCCCA
GTCAGGAGCGAAACCAAGCGACGTCATGCCCGTCTCCTGGTCCGGGTAGATCGTGAATAGCAAGTTGCCCGAGATCTGGCAGCCCACGGCCGAGTACGAC
GTACTAGCGAGTACCAAGAAGAGAACCGACACGAAAGCGACGGTAATACCGACGACACGGGGCATGCGCGTGGGGTCGCTGTGCTGACGCTGCAGGTCCG
GGATGACGATACCGGCGCCGTAGGCGAGCGACAGGTTACCGAACACACCGGCCACCTGCTGGAACTTGAGGTCCGGGAACGGCACGCTGGGGTGGCCGCG
CATGCCATGGATCACTACTGCGACGCCGATGACGTCGGCGATGATCGTGCCCATGCAACCGGCGAAAGCGGCGCCCGAGCCTTCCTTAAGCGTCGGCACT
AGGCAAACCGGCAACACCATGAGAGCCATGAGAATGGTCCACGTCGTTTGGCTGAAAGCGCCGGGGAACAGACCGTCGAGTAGTTGACCGCCGAGCACGA
GGAAGACGCACGGAATCAACAGACACGAGCCCATCTGCGAGATGATGCACAACCAGCGGCCGGTTGCGCCCATGCTCCATTCACCGAGGTCACCGAACGT
CTTGACCGACCGGGGGGCCAGCAGCATCACCTTGGACATGGTGATCGAAGAGTAGATGTTGGCGAACGCCATGAAGGCCATAGCGATCACGGCGATCGTC
GGACCTGCCCGGGCGAAATTACCGGGCATACCAAGCGTTCCAATGCCGTAGATGCAGCAGAAGAGGTTGAAGCACGACTTGAGGTCCTCACCGGTGAGGA
ACGGACCTTTAGCCATGGTGAAGAAGTCCGGATCCGAAGCAGGTAGGTCGAGTGTAGGTTGGAGGGGAAGGACCTGCGGCGGAGGCGGCAGAATGGAGAA
TGAGCTCCTGCTACTCGGTCGGAACGCACTGCAACTTCGACGTTGAGGGCGTCACGAACTGCCGGCACAGGGCACAAAGACGCCGGACTTGTCAAACCAG
CTGAATCACCCCATGCGGGATAAGTGCCGGGACCTGCTGGAGTGCATAGCGCCGAGTTCGTCTTGGATTTCACGCCTTGAGCCTTGAGGCAGTTCCACAT
GGCTTGGACTCCAAGGCATGTGGAACTGCCTCCAAGTTGGAGCTCTGAATTTTAAGGCTTCAACTGCACGCGTTTGTACAATGTTCCATCACCCTGAGGT
TGTTGGACGAGCCAAATGCTAATCAATGCTCTGCGGGATGATCAGCGGCTACGGTCGCATCGTCGGGATATTGCGCCATCATGATGCACAGGGGGTCATC
GGCTCACTGAGCCGATGCACGCAGAACCGGCTCATGTCTAGAGCTGACGGAGCTCTCCAGAAATCCGTCTTCCAGAGAGATGGAACAAGGTGTTTTTAGC
AAGTACTAGTAACTTAAATAAATTCTTCAGACATGACAAAGTAAACGCAAATGCTAATAGAAAAGTGCTCCAGTCATTACTTGTTGAGCCTACTGAAGAA
CATTTCACGAGTAAACGATACACAATGGAGAGTCTCCATCGCAGCACATCGCTAATCTTTGTCAAAGTGTATGATACTGTAGAGGCAATTTGAAGCATCT
TTCAATCAGCGATTCGCAACATCCGGTGCAAGTTTAGCGCGTGTTCGAGCACGGTACTGTAGCCTCGAACAAATTTAAGTGTGGGCCGAGACTACTGACT
CGTGACGGCGTCTCCGTCACAGAGATCAAGCTTGAAAGACGGCGTTGCCCCCTGGTTTAGCTCTGGGTTAGCGCCTGTGAACAGCCAGATGAGTTCCCCG
TGCTCAGAACACAAAGCTGCTATGCACACTCCAGCAGAATCGCCTGCGTATATTTCTGAGAACCAACTTCAATGCACGTTGAAGTGAAGCTTCACTGACG
GAACGCCGGAATATGAGCAGTTGCTGCAAAGATCTCGACAAAATGTACAAACCAGGATGGCAAGGCTCCAGCTGCGGCCGATATGCTGACCTCCACGTGG
CGACAAGATGATTAGGAAGGGGGCAGACACATGAATTTGGACTTGAAACGTGATCACACGACACGCATGAAACAGCAGTGGCAGCTTCAGTAGTACGACA
CTCGCTTTCGATTTGAGAGCCAATGTTGCCTCGTTGGTGGTACATGTACAGTAAATTTCAGTCTAGGCTGAAGAATTAATCTGGAGTGGTTTTTTAATCC
GGTAAATTTTGCGGTGTTTCAAGACTCTCCAGAGTCAAGCACATCGTTGGGATGCAGCATTAGGAAATTCTGAGTGTAGCGACTTGCAACATCTGCATAA
AACCAGGCGTGCATTCGATTTTTGCCCTACAAGATCGCTGCAGGCGGCGTACATGTACATTCCTTCGCTTTTGAGGCACTTGCCTGCAGGAAATTGCTGC
TTCATTTGTATCCACAGTGAAGCATCCTTCAGTTGCCGTGCTTTAGCCAAGACAGGAGCTCTCGTCTAATCAAAACTGCAGCTGGTTGTTTAGACTAAAA
TGCTAACGCCAAAAAGTGGTCGACGCTGTTGCAGCACATCGCTAAAGCAACATCTGGTTCGTTTAACTGAATTACCCTATTAGTGATTCAAAATCACCTT
GAGGGGGTGCACGGTACACTGTAAGTGATTTTAGCGAATTTGTTTACTCAATGCTGCACTCCTGACGCATTGACACTTGGCCTGAGTGCGTTTGAGTAGT
GAGTGACCAGCTCATTCCATAACTATTTTTTTAAGTACATGGAATTAGAACAAGCGTCAATTAGTATCCTCTCGCTACACCTACAGACTGATGTAAGGGA
ACACCGGTAGTGTTACACCGCATGATCATGCCAACCTCCAGATGTGCAGCCACCTTGCAAAGCCATCTTGCATCCGTATCAGGACAACCTCCGTATATAT
TTTCTGAGAATCAACTTCAACAGCTCCGTCTTGATCTCGAGGACGTTCCTACTAAGAGTCTGAACGCCCTCGAGACAGTCTAGAAGGGGTTGAAGTTGGC
CTGGAGATCGCGGGCTTTTCGAAGAGCTCAACCGGAATGGGGTGACGTGATATCGCCGAGAGAATCCCCAACGAAAAAGTTGCAGAGACTACAAGGGCCA
CCGGGTAATTCTCTACAGCTACTATTCGGAGAGTGGATGCAACCGACATCAGCAGTAGATAAGGAAACCATCGCTCGCAGCATCAATCCAGTCCTCGAGA
CGGCCATTAGCTGGACGAAGGAAGAAACCTGGGAGTTGCGGCTCTTTCTACAAATGCCCATCCAAACAGCAGATTGGAGTGCGGAAATGAAGCAGTTTTG
GCCGACTTTCCAGTGGAATGATAACCCATGGATTCGAGACAGGACGGGAGCAATGCTAACGACAGGCAAGTATGGTCATATCCGACCATGCAAGCTTGAA
GAGCTCCACATTCAACGGACCGGGGTATTAGCGTACACCTTCGCCATTCCAAGGGCGGACGGCCAGGAGAAGCTGTATACGCAGGCCAAGTTGAGAAGGT
GGGGGCTTGCGATATTAATGGGGTCACCACAGCTGGACATTGGAGAAGAATTGAGTGTAAAACCCGGCATCAGCATGCGGCACCCTCCGGAGCTACACGC
TGAGTACGAGTGGAGTATCACGAAAGAAGTCCAAATCATGGGAATTCCGCAGGGCAAATCACTGGCTTCGATAATACTCAGCCAAGAGCCCGACGGCATT
CATTGGAAAGTTGAGTGGGTGGACAGCTCCAGACCCACAGCAGTAGCTTATGCAGACTTGCTACACAAACGCCAACAACGAAAAGGCATCGTGTTCTACG
CACATCCTTACGCGCACCGTTTTCCGTGGGGCATTTCGGACACGGTAACGAACCGGCACGCGGTGTCCGCTATCAAGCGATTAGCGTTTCGAAGATACAA
GGAGGAACTTGGCTCAGAGTTGGGTCCGGTACTGGCGCGACTGGAACAAGCAAGCGCCAACGATCAATGGCAGACATGGGTGATGCATCGCACGCCGTCA
CAGCTCTGGGAACACAAGAACACGTTCACGGAGTACCAGCTCTGGGTCGACTACAGGCTCGCAGTACGACAACTCAATCTGTACTTCGAGGGAAGGCAGG
GGGACAATGGATGCCGGAAGCTGGAGCAGTGTTCCAAGACCAAGGAAACATTGACCCACATCTTCTGGGAATGCCCGTGTGCACAGGCCTCTTGGCGGAG
AATCGTGTGTCAATGGACAGGGCAAACATGGAGTCTGGAGCAGTTGCAGCAGTTCCTAGGGGCGTGTGCAAGTCACAAGGCGCCCCCTCTTTCGGCGGTG
ATCAAGGATCATCTCAATTTGCAGTACATGGATGATGTCGGCCTATTTGTCGAGG