Description :
From Genome Similarity Track
Location :
scaffold_60:21330- 22346
Sequence
1016 bases(100 bases per row)
ATATTTGAAATTGATTCGTCTACTGGATACATAAGGCGAAACGTCTCTGGAATCGATTATGAGACTCAAAATCGCTATGAACTCCAGGTTGGAGTCGAAG
ATAACGGCAATTTACTTGCACACGCCACAGTAATGGTTTGGATTGTGGATGTAAACGAACCTCCCATGCAGGTATCAAACTCGATTTTAAAAGTGTCAGA
AACGGCGACTGTCGGCACTATCGTGGGGACAATTAACGTTTACGATCCCGACAAGGACAATTTCGCTGTGTCTATCGTCGACGGCAACCATGGCAATGCT
TTTTCAATCGAGCTTAATACGCTCGTAGTTGCACACGATGTATTAGATTACGAAGCATACGCAATGTACTCGCTGAAGCTCTACATAAATGAGTTACAGG
ACCTCGACCCCCTAGCATCGTATGGAAATATCGTTGTCGTTATCTTGGACGAAAATGAAGCTCCCGTCTGCAATAATCAAACAAGAGCAGTTCCTGAAAA
TTCTCGTATTGGCACTCCTATGGGCAATATTCTCCAGGCGGTAGACCCTGATTTTGGCCAGCAAGTTTCATTTGCTATTGTTGATGGTAATAATAACAAC
TTTTTCGCGTTGGACTCGGTTACTGGACAACTTAGTGTTGGCGAAGGTCCATTGCAGAGTTTTATTGGATGTTTCTCACAGCTTCAAACCGGGTTGGCAG
GGCCGTTTAGTACATTTCGGGGGGGCAAACCTTTGAGAGATTGCTACAACATGTGCATTGGGTCCCAATTCATGGCTCTAGGTTTTGGTGCAGAATGTTG
GTGTGCTACTCCAGCTATAGTGGATTATAAACTTACTTCGACTCTATGTGATACAGTCTGTGATGATGCACCAGACAAGAATTGTGGAGGAACGAACCAA
TATGCAGTATACGAGATCGGGGCTGTTTTGGACTACGAGAAAACGCATAACTATGTTCTTTTGATGAGTGCACGTGACGACGGAAGTCCTGCCATCAGTA
CAATGTTTAACGTCAC