Description :
From Genome Similarity Track
Location :
Scaffold_280:2133- 7233
Transcript NameFunction/comments
Phyag_g4252hypothetical protein

Sequence
5100 bases(100 bases per row)
TGAGTTGCCAGctcacgcaagaagcagcaagttaCAAGTGGTTATGAGCCCAACGTCACGTTGGTGACTCAACAGATAATCTATCAGCATGAGTACGAAC
GCAgaccagaagaaggaggcaaAGGAAGAAAAGAAGGCAGCTCACCCTCCGTTCGATGGCCAAGATTTTGAAGTGTGGTTTGAgcggatgaagttgaagc
ttgAGCGCAAGGACTTGCGGATATACTGTGAGAAGGAGGTTGATGAGCCAGAAGAGTCCAAGCAGGACGAGCATGCGAcctggaagaaggagacgtcgcg
tgtgaaggagctgctctACGACAGAATGACAGATAAAATTATGAAGACAGTGAAATTTGAGCCTTCCGCATTTCGTGTAGTGGAGAGATTGAAGCAGCGA
TTCGTTGGAAAGACATATTTCGAGTATGCTGCAGAAATGACTCAATTAAGACTGCTTCGACTACATCAAAATGGAAACGTCTCGAATCATTTGGGTGAAG
TCCGGCGGTTAATGGACCGAATTGCTCTACTGGGGAAACCCCTTGATGAATATGAGAAACCTGCACTTCTGATCGGCACACCACCTCCAACGTATGATAA
TGTTGTGGAGACTTTCTTGGCAAGCCACGTGCCCCGTGACGTCAATGATCCACCAAATTATGAACAACTTGAACATGCTCTGGAAGTGGCGTTTGATCGG
CGTCAAGGCAGAAAGCTGGATAGCAATACAGACGATCAAGCGTTATATGATGGCTCTGAACGAGGTCGAGGTAGAGGTCGACGTAGAGGCAGAGGACAAG
GTCGAGGCCGTGGTTGCGGCTTTGatggtggtcgtggtggccgcggaggaggacgtggcaGAGGTAGAGGATTTGGAAGTGGACGTAGTGCTGGGCAAGG
TAACAgccaaggtggacgtggtcgtggtggacAGAGCGACACCAGAGGAAAATGTTACCATTGTGGAGAGCAGTCGCACCATGTGTGTGACTGTCCACAC
TTAGGCAAACGACCACCGAGTGATGCACAAGGAAGTGAGGTTCAACAGAAACAAATAAACCTTGGAGGAAAATCACAAGGGAAGAAAGCTGCCACCAAAG
GAAATTATGTTGGTGATGATAGTGATGATGGCGCATATGTGGTTTCAGCACTTCTGGGGAAACCTGCACatatgttgaagttggcacACAATCGTTGGTA
TTTGGATTCTGGAGCAACAAATCACATGACTAACCAGCAAATTGACTTTGTCTCATTCACACCAGTTAGTGCTTTGGTGCGAGTTGGTGGGGAGAACTGG
CTAAGTGTGTCTGGCATTGGTACAGTAAAAAAGGAGATCCAAATGACAACTGGGAGACGTACGATGGTATTACGTGACGTGCGTTATGTACCTGAGCTTC
AGTGTAGCTTGTTTTCGGTGCGTCGCCAGGCTGCACGAGCTTTGCCAGCTGATGAAAAGGTCAGAGTTCACATGGATAATGATGAATTTGCTAAAGTGAA
GTTCGAACGAGGAAGCGCAAATGCACATGTTGATGAAGCCAGTCTGTATTGTTTGGGGCTGGAGACACCTGTCGATTCAGCCATGGTTGTGGCAGTCAAT
GCGAAGCAAGATGCGCGCCTGTGGCATACAAGACTGGGCCACCCTGGACGCAGTGTGTTTAACGCGCTATTCCGCCATGCTGAGTGGCCGCTGGCTGCAG
TTGATTTGAGAGTTGATGGATCATTTAGCTGTGAGTCATGCGTAAAAGGGAAAATGACGAGAAAGAGTTTTCACTCAACAAaaggtgctgcaggtcgtgA
ATAGTTAGTTGGAGAACGTGCTCATCTGGATGTTTGGGGGCCATATGCAGTTGCGTCTTACTCTGGAAAACGATATTTTGCCCTCTTTGTTGATGAAGCC
AGTCGGTTTCCATCTCTGTTTCATATGGAGGAACGGACGGAGATCTACGATATCTTCGAGAACTACTATGCGCATGTGAAGACTCAGCTAAAAGTGCGTA
TGAAGGAGCTCCGATGTGATAATGCACGCGAACTTCTAGCTCTCGGAGAGAGATGCAAGAAGAATTATGGGATGGATTGCTCCGAGACTGTGAAACATAC
GCCAGAACAAAATGGTGTTGCCGAAAGGATGATTCGCACAATAACTGAGCGCATACGTTGTCTGTTGGTGCGTTTTGGACTACCTGAGGAGCTGTgggca
gaagctgctgttaCAGCTGCGTACAGTGTGAATATTGTGCCAAATACAACGAGAGGAATGGAAGTTCCTTATTCAGTGTGGTTTCGAGAGACACCTGAAT
ATTCACGACTTCGGACATTTGGCTGTGCGGTGATGGCATATATTGACAAGTGTGAGCGtaagaagttgcagcaaaaAGCTCGGGAAGCTGTTTTTGTGGG
TTATTCTCGGGAGAAGAGAGGTTATCGTCTGCTTGATAGCAAGACAAACAAGTTGTTTTACAGTCATACGGCAATCTTCTACGAGAATAAGTCAGGACGT
ATCCTGTTGAAGGATGCTTCTAACACTACCGCGAGTGTTTCAACAGCTCGATACTTGAGTATTGATGCTGTGGCCATGCGGGAAATCCCATCACTGCTGA
GAGATGCACGAGACAGTGAGAACTGCGACTCGGAAGGCAGAACTGGTGGGGCTGATGAAGGTGCAGTTCGAAATACAGATAATGTGGTACAAAGTAGTCG
AAAGCgaaaagctggagctgctggtggaaaGCCCCCATCCAAAAGAGTGCGGAGAACTGACGTAGTAGTAGATTCACGTGATGATGAATTGGTGAGTGAG
TCAGAGGAATCTCACAAGAAAAAGAGAAAAAGTGCACCTtcaaagaagaaaacgcaGAAAACCAAAAGGTGCTGCGTGACACCTAGAGGAGTGTCTGAAA
ATGAGAGCAGTGGGCGGTGTGTGACACCGACTGCCGAGCAAGATGAGAAAGTCACAGAGCCACTAGGGTCTTCAACACCAGTAATGGGTGAGATGACGAC
CAACAGAGTGGACGAGTCTGGTGCTGACGACAACTCGGATGAGGAGCGCCTGACCGCCTCTGAGAGTCGGGATGAGTCGTGCAGCAAGACGCCAACGACT
TTGTGCAGAGAGTATCATCCATAGAGGacaagaagtggaagagTGTCCAAGCCACCGCGATGGTCGGGTGATAGCCTTCATCTTGCATACCGAGAATCAA
TTGGGAAGAAGCATGTTGGTTCATCGAGTGGGAAAGAGGCACAAGATGAGATGCAGTTTGAAATAGCAAAGGAGAAAGCGTTGGATTGGTGGCAAGATCT
CTGCTGTCTTTCAACGAGTGTCCTCACTGAACCAACTACATTGGAGGAAGCAATGAGTAGTGAACACGCCAATGAGTGGCTAGATACCACAAAAGCCGAG
TACAGAGCTTTGACGAAAAATGACACCTGGAAGTTGGTACCTCGCAAGAAAGGCATGAAAGTGCTCAGCAATCGTTGGATATTTCGAGTGAAGTATCAAT
CGAGCGGGGAGATTGAGCGATTTAAAGCCAGGTTGGTCATAAAGGGCTTCATGCAGATCTACGGGATTGATTATTTGGAAGTGTACTTACCTGTAGTTCG
CTTGGAGACTCTGAGGATGTTGTTGACCCTCGCAGCCATTTGGAACTATGAAATGGACCAAATGGATGTGGTCACTGCATTTTTGAACGGTGATattgat
gttgaagtgtaTATGGAGCAACCAGAGGGGTTTGTGGAGGAAGGCAAAGAGGACTGGGTGTGTCTTCTGCTGAAAAGCTTGTATGGCTTAAAACAAGCCC
CGAGAGTGTGGTTCCGTCTGCTAAAAGATTACTTGGAAAGTGAAGGATACACACTCATGAACTGCGAGGCGTGTGTTGCAGTGAAAGTGATCGATGGGTG
GCTTGTGTTCATCTCTATCTACGTTGATGATTTGATCCTGTTTGCGCCCAACAAGgtgatgatgaagcagatgaagcaaaTGCTTCACAGACGTTTTGCA
ATGAAAGACCTTGGAGCAATTCACTACATTCTTGGTTGGGAAATCACACGCAATAAAAGTGATCGGACAATTTTCATTAATCAGAGGAAGTATGCAAGTA
TGGTGTTGCATCGTTTCGGAATGGAGAATTGCAATGGCGCTAAAGTTCCAAGTACTGCTGACTTGAAGTTATCGAAAGTAATGTGTCCAATCACGAGAGA
TGAGAAGGAGTTGATGACCGGAAAGCCCTATCGAGCTGTAATTGGGAGTTTGATGTACTTAATGTTGGGCACACGCCCTGATTTGGCTTACCTGGTTCGA
GAGTGCAGTCAATTTCTTGAGAACCCAGGCTTACTGCACTGGCGCGCTGCAAAACATGGCCTACGTTATCTGAAAGCTACAACGGACTGGGGATTATGTC
TTGGAGGTGTACAATGGAGTGAACAACAATTGGATGACCATCTCAAAGCTTTTGCAGATGCTGACTTTGCGAATCGGGTTGATGATCGAAAGTCTATTGC
TGGGTATTTGACTCAGTTGTGTGGTAGTACAACTTCATGGTGCAGCCAAACAGAAAGAATAGTCGCATTGCACACCACGGAAGCGGAGTATATGGCATTA
AGTTTATTGGTTCAAGAGGTTGTCCATCTTCGTCAGATGATGAAAGAActgaaggtgaagcagaGACATCCTTCAGAAGTGTTCGTCGACTATGAAAGCG
CGAGGAAGTTAGCAAACAACCCTGAATTTCACGGCAGAACGAAACACATTGATGTTCGTCATCATTTCATTCGGGAACGTTTGGAGTTGAAACAGATTTC
CGTGCAACGAGTACCTGGTGTTGACAACATTGCAGATACCTTTACGAAACCGCTGTCACGTGTGAAGTTTGAACAGCACAGGGCAAGTATGGGATTGATG
TCCCAAGCTGATTacaagacgatgaagcgTCCAAGCAACGAAGATAAGCAGTAGGTGGGGCTGTTGTGAAGTACTGGTTCCTatagttgctgcagagcag
ttTAGCTTTTTCCCTGCAGGGCTTTGCTAACTTGCTACGGATTGGAGAAAAACTAAAACGGTATCTGGGAATGGTGAGAGAAGGAAAGAGGGAGGCAGAA