Description :
From Genome Similarity Track
Location :
contig_35:213293- 215648
Transcript NameFunction/comments
g6768.t1hypothetical protein PHYSODRAFT_347033

Sequence
2355 bases(100 bases per row)
AGTCAGAGTTGGAGTCAACCGATCCGTCGTCCATCTATGACGCTGGTTACGGGCAGCTTGCATACGTGTGTACTCCAAAGGATGTTGTTATCTGTCGCCT
GCGTGACGCTGACGACCGCGTGCAGTGGGCGCTGGCACGAAAGCAGTATGCCAGAGCCCTTGACGTGGCCCTTCACGACCCACGTGCTCTTCGACGCGTG
GTGCTCACTGACGTTATGGAGACGTACCTTGGCGATCTGCTGCGGCAGAAGAAGTTTCAGAAAACTGCAGAGGAGATCCATCGGCTTTTTATCGGTGGCG
GCGAAGATTACGCAAATTTGTGGGAAAAATACGTCTACGTGTTTGCCCAGCGTGGGCAACTGAGTGCTATTGCCTGCTACATGCCAACGGCCAGCCCGCG
GTTGCCCAAGGTGCAATACGAGATGGTTCTGAAGCATTTTTTGGATTCAGATCCGGGTCAGCTCCTCGAGCTCATTCGGAAATGGCCGAAGCCCCGACGA
CAGGACACTTTAGCAGCAAAGCAGCGATCGGAAGGCGACGCCTCCGCTGTTGCACCGGAATACACCGAAACAACGCATGTGTTTGAGCCCCTGTATGACG
CTCAGGCATGGATTAACCAGCTAGAGACGGTTGTGCGTCGCCGACGCATTGCTGAGGCGGACGCAGAGCGATTAAGTGTGGAGACAATGTACCTGATGGA
GGCTCTCGCGGAGCTGTACACAGCCACAGAGCAGTATGACCACGCGCTGCGTATTTACTTAAGCCAAGGTGAGTTCTGCTCCAACAAGGACTTCGCATTC
AAGCTTATCACCGAGCACCAGTTGTGGTCGCTGGTTGCGAACAAGGTGGCCAACCTCATGCGCATCGATAAGGCAATTGCTGTGCGGATGCTCGTGAATC
AGACGGAACAGCTCAAGATCAGCGATATTGTTACTCAACTTGAAGGCGAGCCCGAACTGCTGCACACCTACCTGCACGAGCTCGTCCTCCACCGATTGGG
TGAATACAACTCGGAGATTTACTCGGCACTGCACGAGAAACAGGTTGCACTATATGCCGAGTTTGCACCGGATTTCCTACTCAAGTTCCTGCAGACGAGC
AACTTTGTGCCGCTGGAGAAGGTAAATTTGGGGTGGTTGCGATGCCGTTAGGTGAGCTCTGGTACTTAACTGATTCATTTTTGCTGCTATTAGGCTTACA
AGTACTGCAGCGAGCATTCTCCTCCGCTCTGGGACACGATGATCTACATCTTGGGTCGCATGGGGCAGCACAAGAAGGCACTCGACCTTATCTTGACACA
GCGTGGTGATATCAACCAGGCCATCCAGTTCGTGCAGGATCACGATGAAGGTCTGTGGGACTACCTCATCGATCTAAGCCTCACGAGCAAGGACAACGTG
GAGGAGCTGCTGAAGTTCGCTTCGCAGCATAAGATTGACCCGATCAAGCTCATTCGCAAGGTACGCAGCGCAGTCGTGATGGTATGCGGGATGGCTCAAT
TTACTAACGCTTTTTATCGTACACACCTGACAGATTCCTGACGACATGGAGATTGTAAATCTCAAGCAGAAACTGATCGCGATCATCGCCAACTATCGCG
TTCAAGTAGGTGGCGATTGTGTTTGTTGATGGAACAAATCAAGCTGCTCATTTGCTGATCACTGTGCCTTTGCCATACAGCAAAACCTGTGCGTAGGTTC
TCGGAAGGTGTTTGACAACGACCGCGTGGAGCTTCTGCACCGACAAGTCACTGCACACAAGCGAGGTCGGCGCGTGGCCGCCAAGAAAGCGTGCGCCATC
TGCAACGAGTTGCTGCGCGCGCCGTCCACCGGCATGGAAACGGTCCACGCGTGTGTGTTCGAGTGCGGCCACTGCTACCACCTCCCGTGCCTTGAGGAGA
AGATGCGCATGTGGAAAAGCGCCGAGGCCGTGGAGTCCGGCGACTTAAACCGCGCGCTCGGCTGCTTCGTGTGCGACCACAGCACACGCGCGTACGCACG
TTCAGGCGACTTCAGCCAGCAGATCGCATCGCTGACCGCACCACCCGCGCGAGGCGTGACCGAGGACCAGCTGCAGCGTGCGAAGGACAACCTCCTCGCA
AGTGTGGCGGAGTAAGGCCAGGGTATTGAGTGCAGCAGAAGTTTGCGTTGAAAGGTGTCTGTAAATCTACACTTTTTGGTGGTGTGTACGTTTCCCAAAG
TTACTGCGTGTTCAACGTTGACGGCGATCCTCCACTTCCGTAACCGTGAATGGAACTGAAAGAACCTCGCTCAACACTGCAATGACAGACCTGCACCTGC
GTTCCACCTTCCTGCTCTGTACGACGCCATCTCCCTGACAAGAAATTCAAACCTC