Description :
From Genome Similarity Track
Location :
Scaffold_55:21327- 24574
Sequence
3247 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCAG
TCTGCTACACTTCCTCCGACAGCGGCGTCATCAACCGGTCCTTTGGCGCTTCTTGCCCCGGACTCTTCACTCCCTGCGGTAGCTCCTGCAGCACTCCCCG
TCGTCGCTGAATCCGCGGAGATGGCTCCTGCTGCTCCTTCTGCCCCAGCTGGTGACCCACCACTACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGA
AAGTACGGAGGCATCGGTCGATCACATGATGACCTCGATAATCCCGTACTTGACTGCAATAGCTCGTCACCAAGTGCAGCTCAGCGTTGCGCCTCCTCTC
CACGGCGATATACACACTCAGCGTCGCCACGAGACTGCTGTTGGTTTCGATGATGTCCTCGCTGCGGTACAGCCTGTTCCTGACGCGCTGTCGGCATTAC
CCGAACGAGTCGCCCGACTTGGAGCGTCTGTTGCGGTTCGCTCAGTCCGAGGCTGTTGCCGCCGTACGTTCGGTGGCACCCGAAATCATGGCTCGTGAGA
ACGCGGAGGCGTTCCTCAAGGCTGCTAACGCTGAGATTGAAGCCCTTCACCACAATGTCAAGATCCTCCGCGAGTCGAATGCCAAGAACGACGCCATGCT
CGCCACCTTTCAAGCCACTATGGAGCGACACGCAGAAGACTTGAATCGTCTGCACTGCGAGGTCCAAGCTCGGGACGTTTTCATCAGCACTTTGCAAAAG
AAGCTGGCTCGCGAACGCGAGGTGTACAAGTCTTCTATTGGAGCGAATACCGAGCAGACTCGGAAGCTTCACCTCCTTCCGGTAAAGCTTGCCCAGGGCA
AGTACGTTGATAACGACACGCTCAAGGTCCTTGAGAACCAGCAAGACCGTATCACTCGCCTCCTCCAAGCGAATCGTACCCTCCGTGCACACGTGAGTCT
GGCCGGGATGGATCCCGAGGTACTTCGTCTGGCTATTGAAGGTACGCTCTTAATGTCGCTCCTTCCACCGTGTGTTCAGCAACTAACGTTCGCTCACAAT
CCTTCGTGATAGGTCTGACTGCGGGTGAGCTGGACCTGGACGCGCTGGACTTGAATCGGGAGACGTTAGTCGCTCTGCGGCGCATTCAGTCTGCCACCGC
GTCTTCGAACGATCCTCAAGCCCTTCCTGCAGCTTTGGCCAAAGCCGCTCACCAAGTGGCCCATGGGAAGTCCCATAAGCGTCTTAGACCAGGTGGCGAG
GATTCAGACGACGTGCCGGACGACTCTGACGAAGACAAGGCTCCAATCCCAACGGACAAGGCCAGTGCTTCGATGGCAGCTGCCGGTCTCGGTGATGCGC
CACCTGCCGATATTTCAACTCCCAAGTCGGCTCGTAGATCGCTGTTCGGTCCGAAGGCGTGGAAGAAGGCGGCCCAGAAGAAGCGCAAGAAACCCCGTCC
TCATTCTCCTGCTAAGTCGCCACGACGTCATATGAAGACTCGATCCAAGTCTGTACCGTCTTCTCCAAGTTCATGGTCGCCACCTCCTACACCAGCGTCT
TCCTCGACTCCCGCCGTGGTCGACCTCAGCGGCGACCAGAGTGGCGTAGACATGGGGACTGCTGATCCAGGCAGCGTCCCTTCGGTTCAAGAAACTGCTA
CAGAGCCTTCGGGTAAGGATGTGAACCCTGGGGATCACGACGATGTTCCCGTCTCTCCTGACTCGTCTTAGCCCTCCACACGATGTGGCCAAGTCACCAG
CTTCAACGATTTCACCTTCTCCAGCCGACATACGTGCTGCTGAAGAGGCTCTGCGCGAGGCCGAGGAAATGCGGCTCATGTTTGACTCAAGTGACGAAGG
TGAAGAGTCGGACCAAACTGTCCCACAAGGCAAGTCTGCTTCGGTGGTGATCCCACTACTCACACCGAAGATTCGCTGCGCGCCATGCTGGCTGAAAGTA
CGGAGGCATCGGTCGATCACATGATGACCTCGATAATCCCGTACTTGACTGCAATGGCTCGTCACCAAGTGCAGCTCAGCGTTGCGCCTCCTCTCCACGG
CGATATACACACTCAGCGTCGCCTCGAGACTGCTGTTGGTTTCGATGATGTCCTCGCTGCGGTACAGCCTGTTCCTGACGCGCTGTCGGCATTACCCGAA
CGAGTCGCCGACTTAGAGCGTCAGTTGCGGTTCGCTCAGTCCGAGGCTGCTGCCGCCGTACGTTCGGTGGCACCCGAATTCATGGCTCGTGAGAGCGCGG
AGGCGTTCCTCAAGGCTGCCAACGCTGAGATTGAAGCCCTTCACCACAATGTCAAGATTTTCCGCGAGTCGAGTGAATGCCAAGAACGACGCCATGCTCG
CCACCGTTCAAGCCACTATGAAGCGACACGCAGAAGACTTGAATCGTCTGCACTGCGAGGTCCAAGCTCGGGACGTTTTCATCAGCACTTTGCAAAAGAA
GCTGGCTCGCGAACGCGAGGTGTACAAGTCTTCTATTGAAGCGAATA