Description :
From Genome Similarity Track
Location :
Scaffold_218:21324- 24898
Transcript NameFunction/comments
Phyag_g3610hypothetical protein
Phyag_g3611conserved hypothetical protein

Sequence
3574 bases(100 bases per row)
TTACTGCAACTATGACGACTAGGATTGTATTGGCAGATGAGAGGCCTCCGTCGCACTCGTTCTGGTACgtgaagacgctgtcgaagagCTCTTTGCAGGT
CGTTAAGGTCACGTTGGTGGACGTTGTGTTGCAGGATTGGAGAGCCTGAGCagcggcgcagcaggaggacgaggcggaGGACGTCTGTTTGGAGCACATG
ACGCGGCACACGGAGTCTCCGTTGaagtcgtcatcgtcatcaaagGATCcagaagaggagaaggaggaggaggagcttgaATTATCATTGTCCCGAAAGT
CTGCTGGGAGCAGGTCGAAAAGCCCAGAGTTGGTGACGCACAGACCGTAGGCAATGTCGTTCTCTAGCACGGTGGTGACGCAGTTAGACAGCGCGGTTAC
GGTGGCGctctcggcgtcgtcggagGACCCAgcgtcggccatggcgaGCGGATTTTGGCTTATGGCATGGCAGGTTCAGCTAGCGAGACTGATTAACGGA
CGAAAAGTGATGAAATCAAACCCCCACGTAATCATCCGACGGACCTGTGGGAATAAGAGGCACCTCTGAATGTAGATGGATCTGAGGATAGATTTAGCGT
ATCAGTCGACGAGTAGGGGACTGTGAAAACGAATCAAATGCGAAATAGGATATATGTGTACACCACACAAAGTGGCGCAGGGACAAAGTGGACAGTGTTT
GCTTGACGCCGTGTGACTGCGGGAAGCGTGCTGGCATCGTTTAACGCAGCTCTAGCTTTGCTGTCCGTGCCGGCCATTTTCCGTCTGCGCCAGCGAGTCG
ATCGCTCGCAGCGGATTTCTCTAGCTCATTTGCTTGTCGATCCAGGGCGTGACGAACTTTGTTAACACATCGGGGCTTCGCCTAGTTTTTTGCTCAAGAC
ATCCACGTTGGCGTTGCGCAGGTTGGGGCAGGAATGACTTTCGAGTGCGCTTGAGGGACTTCCGAGGTGCACCAACTTGTTTTATAACGAAGTAGGGGAG
GCATCACAGTGTGTAGCATGGCATTTCATGCGTGCTTTGAGGAACTCACTTTGCTTCATTGCCGTCGTGGGTACGCCTTCAGAAGTATCAAGTGATCCAG
TATCGCCCGAGGTATGATAGACCCCGCTAGTCGCCGACTTGGTGCCTGCGTTTCGGCTGGTTAAGTCCCTCGACATTTCATCCGTTGAATTGAGTCAAAT
GCCACAAAACAAAAAGGCTTGACTTCCTCCATTCTGTACTCGAACACATTCTCACTCCCGCAGATTGTGACCCATCGCGCTTCGCCGCGTGGGTTGCTTT
GTCCGCAGTGAGTTTACGGCGTTCGTCGGCGTCGCAAAGCGGCCCAATCGACTCATGGGGTAAGAGTGCGAGTCTCGACGTGGACCAATTTTAACGAGAT
GATCTCAAGTCCATGTTATCGGTAAGGAATCCACGACCGCGGCAGCTACAGCAGTTTGTCCGCACACTCAATGGTGGCGGTCGTCCCAAACACAAGCTCC
ATGTTCGTTGTAACTTGCAAGCCCCAGAACGAGCTCTTTCGTCCGACCTTACAGTGTAAGGCTTACACCGCTGAAGTAATCACTTCAGCGCTCGTTCAAC
ATGGTTAAAGACATAATTCACCGCTGCAAATCAACTTGATGTGACCAAGTTATCACGGCGTTAACCGCCATAACTCTGCCAGCTTGTTCACACGTATGAC
CCAACAGTGGCAAGCAAATTGCTTGAAGCAATCGGGGATTCTGCAGGATTCACGACGTTGGAACGCTGGACGGGAGCGAGAGTGTGGATGATCCACTGAA
TCCACTGGATCCGCTGCACCGACAGCAGGGGCACAGCCGCGGGGCGGCCGACAGCCGAATACGCGGCGTCCCCATCGCGAGGGAAAGCGAACGGTGCCGC
GTAATCTCCAATACCGTAACCAGCTGCCTGGTCGATGCGCTACGTTCACGATCGACTGGACAAGGTGCGCGCTGGTACGATAGCTAATGCGCCTATGCCC
GCCATGGCAAAGGGGGGGAATCCCGGCAGACAACCAGGGCAAGGCAGGAGATGCAACAGTGGATGTCGCTAGATTACGCTGTGCCCGTCCGCTTTGATTG
GTCGGCACACTTCAACATGGGTACCTAAAGTCTCCTCTCTATCCTGATATCCAGCGGGTAGGAAGAGTTTACTATTCAAAGTTCATTCGATACAAATCCG
CTCGCATATTTCGATGTCACCatcacttgctgcttcagaaaCTTGATTTCGCGTCGTGTCGCAGTGCTATTATGGCCATCTAGCAGAAGGCCCAAGCGTG
CGACAGCTACGATTCcttccttcttcacggcATTCGAGGACTTCCAGCCAAGCTCCAAGCGCGCCAAAATGCCAGTGCAGTCGCTGCGGACGTCCGTCGG
CAGTCTCGGCCACACTGTGGGCGACACTTGCATCGACCTGTACGCCGAGCGGGTCATGATCCCGCGgatctcgctcttctcgctgctcaCGGGCCTGTTC
GTGCTCTCTCTGCTGCTCAtccgccaccgtcgccaacggCATCGACGCACTCGCCAATTGGCAAAGCTCCTGCCAGAGAATAAGATCGTCCTAGAACCTT
ctccagcctcctcctccaccagcaacgacgatTCCCATACAAAGCAGTGGTTCGTCTGCTTCATAACCACAACTGTCGCGTggatcatcatcttcctcta
CACTttcaactcgtccaccgtcatgacgtccacctccatgagCGCAGCACAGGCGCGACCCCGaatcgtcttcagcttcacgacgacgccacgagGCATC
AACGACATGCAGCCGACggtggacgcgctggtgcGGCAGGAGGgcgacggcttcgacgtcgtgtACGTCATCGTTCCAAAGATGTATCGAGACAAAGTTG
TGGACGTGCCCAAGTGGTTATTGGACGACCACACGAAACTCGATCGAGCCGAGTTCCGGGGCATCACTTTTGCTATTGGAACGAGTCCGTTTCACTCAAA
ACTGAGAGTTATCGTGCTGGATACGGACTTTGGTCCTGCTAGCAAGGTGCTGGGGACGctgttggtggagcaggaccCGGACACTATTATTGTGTACGGT
GACGATGATCGGGTGTATCCGCCGCAACTGTGTGAGCGAGCTCTGCACTATACGCACAAGTATCCGGAcgatgcagttgcagtgTTGGGAGGGTGGATCT
CGGCCGAGGACGGACTGTACTGCGGTCGCAGTCTGGCGGTGGGGGTGAATAGTGTCTCGTTCGTGggaggagcaggtggagtCGCTGTTAAGAGGAAGTT
TTTTGGACTGGAAGAGGCGACGATGCCGGCCTTCGAGATCGCCAACATGTCTAAGGCTTGCTTTCTCGGTGACGACTATTATCTGTCGCACTTGCTCAGT
CGCAACCGCGTGCGGAGGCGGATCGTGTCCGATAGCTGCTGGAACATCGAGTCGCTGAAAGAATCTTTCACTCATGGGGGATTATCATACGCTCCGTCTG
AACATCCAGGAGGAGCAAATGTGGAACACTACCAGCAGTGTATTCGAGAGCTAGGCGAGGACCAGGACCTCTCT