Description :
From Genome Similarity Track
Location :
Scaffold_212:21320- 22777
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_212-fgenesh-gene-0.14Ubiquitin carboxyl-terminal hydrolase
Pytul_var.sporangiiferummaker-pug3_contig_212-snap-gene-0.30Conserved gene of unknown function

Sequence
1457 bases(100 bases per row)
GGGATGTAGTTGTGCTTGCGACGTCGGTTCTCGAGCGCCCAGTTTGAGCGCTTGTGCGTTTCCTCGGCGATCGTGGCCTGCAGGTGCGCGATCTCCTGCG
AGACCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTTGCGCGAGCTTCTCCTGCGCAATGTCTATCCGGTTGCGCACGAGCGCCAGC
AGGTTGAAGCGGATNNNNNNNNNNGACGCCGCGTACTTTTCGATGCGCTTCTGGATCACGGGACACGCGACTTGGAGCCACGCGTCTTGCTGCTGGGTCT
GCGGCAACTCGCCCAAGTCAATGGGGCCAGGGCGAAGTCCATCGAGCTCGTAGACCCTGCCATTCACGGGCACATACGCGATAAAGTGGTAGACATCGTC
ATCGCCCGTCGCCTTCCGCTCTTCCATCACGAACGGCTCGGGCCGCGAGAACGAGTNNNNNNNNNNNNNNNNNNNNNNNNNTGCGTGATACGGATCTTCT
CACTGTTGGAGATCGCGAGCCCCTTAAGATCCGATGGGAAGTCGCTCGTGAACGTCTTGAACTCGGACAGCGTCTCGCCCAACGCAATGTCCTTGCAGTT
CATCAGGATCGACAGGATCGCCTGCGTCGCACACGCGTTATTGATCACCTGCTTGGCGAAAAACAAGCCATTCTCTTCGGCGTCGTGCGCGTACTGCACG
CGCTGCTGGTCCTCGTCCGCGCCATGGGAGGTCTCGTACTTGAACAGAAACACGAGACCGTACACGGGCGACAGCTCCGCAAACTGCTCCGGATCCAGCG
AGTAGAGCTCCTCCACCTGCACGCCCTTGACGCCAATGTCTTCGATCAACGACGTGAATACGCCTACGTGTGGATACGCATTAAGTGCAGTCACGACAAA
GGAAAAGATCGAGAAGAAGACGTGGTTTAGCGAGATCTAAAGCACACACAGAAGAGCCCAGTGCATAGATCACATATGCATATAGAGAGCTGCATATGCA
GTACATCCGTCTAGTGTACGCTACGCACCTGGATCGGACTCAATCGTGCACCACGACATGCTGCTTTCCTCCTGCTCTTGTTCTCCCTTCTTGTGCTGTT
GTGTTGCTGAAGGTGCAAATGGGGATCAAACCCAGGAACGTGTTTGTTAAGTTACCTGTTATATCAGACTAGCTATTTCGGTTACATCTATTTCAACTGC
TCGTCGACAGAGCGGAGCTGTGCGCGCAACTGGATCAGATTCTGCTTGATGCGCTCCGTTTGATGCGCGTTCTGCGAGCCAAACGTGAGCACTAGGTGCG
CGCTCTCGGCCTGGATGTCCAGACACAGTTGGCGCCGCTTTTCGACCAGCTCCGCATGACTCAATGGCGCAGTTGTTGTTTGTGGCACTTCCAAAGCTGC
ATGGTCGGCATTCGATGCACCTTCATGCGCTTCTTGAGGTTGCACAGATGCAGTTGC