Description :
From Genome Similarity Track
Location :
Scaffold_15:213186- 217778
Sequence
4592 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGACGGCA
GCAAATGCGGATTTCATGTTGACCAGCAATTTGCCGTAGGCAATACAGTCACAAATTAAACTGCTAAGAGTCTAGCTCTAAGCGAATAGTCGGAAAGAAA
GAAAGTCATTAACCATAGCACGCAGACCCAACATAGAGACGACATAACCGAAGGATTGATATTAAAAATCGAGGCACAAGGACCTACGCAAAGGATTGAA
TGCGCAGTCGCTACGCTCACGCACCCTGCTCCATGTACACCTCTGTGTGTCCATTCACTTCCTGAAGCAACCTTTTAGCGATAAACGCATGTTTTGGCTT
AGTGTATGTCCTCCGGTACTACACTCATCTTGGCGACTTTACTCGATCGAGTTGTTTCTCAATGGGGAATTAACAAATCCTGGTACTATCGAGGATCCAT
TGCCAAATCCAGGAAGATTCGCCAGATACTAGTATTATAATGAGCTAGTTCACTCTACCCGGATCCAGCATATTGTATACACATCCGTTCCGGCATGCTA
TCACGGAGATTTCATACAAAATAATCAGGATAAGCATACCAGCTGCCTCCAAATATACACCAGCAGGTGGTATATTTTGCTTCTCATCTGTTGATATCAG
GAATAGTGCGAACTTAACGAACTTAAGGTATACCAGAACCGCGTAGTGTGAGCTCCCCCCCAATATGGCAAACACGATTGTCACTTTAGTACGGTGCCTA
GGTGGCTCCTCCTCGCTCTGTGTTGGGATGCGGATCTTCACGCAACACTACGCAATACTACATGCCAAGGGCATTACACTCACGCAGGACAACTGCTAAA
CACCAAGCTGTCCAGAGGGACAGCAAATGTGTATGCGTGTTCAAATAAAACCAAGTATCCTTTAAAGTATGTACCATTCAACAAAATAGCGCTGTGGCAG
GCGATCTCTATCGTCAGTTCATTTATCGCTGAGAAGAACAGCCGTATCGGCTCCGCTGACGCAACATCAGGTCTACTCGCTAGAACGGGCCAAGCCCGAG
CAACGCAAAGCATTTTGAGCTACCTCTAGACAAAAACTCAACTCCGATGAGGCTGTACTCGCGTCTCTCCCCCGTTGAGAAAGATCGTCGAAATGGGCTA
GTTCACACTACCCCTACCCGGCATACTGTATACACATCCGTTCCCTCATGCTATCATGGAGCTATTTCGGTTCGTTTTTTTGCCTCTTTTCTGTTGATTT
CAGGAATAGTTTGAACTTAATGAATCTAAGGTATACCAGAACGGGTATTAGTGCTAACTTCTCCAATAGGAAGCGAGTTTGGAGCCGTGGTATAAAAAGG
TCTCAGGTCCCGCTTATGTATACATATGTACACGTAGTGTGTCAATAAGTTGTGTAAGGCTGCGTGTCGTGATGTTGTCTAGAAGCTGCTTGTTCTACAG
GCAACTTTTTTGGAACGAATTAATCTGTGCGAGGCTGTCCAAACAGCTCTTCAGCTGACCTCCCAGGATAACCTGTTTATACAGATATGGTTGAAGTACT
GCTCCATATCGATTAATGGCTCCCACTGAAGCCTTACGACAGAGGGCACTTGGTGGACCAAGTGATAGCGCCTCATGATCTTTTTCGGATGCAGACGGGA
TTACTAGACGCTGCGCGACGCTGCCGCTTCTGTTCCTTCAGCACTGCAACGCGCACAGCCACCGCCATGCTCACATTGATGTATCGGTCGTCACTAAATA
GAGAGCTTGCCTCGTAATAGAGGTGGTTCAATTCGTACAAATCGAAAGTGGACCAATGCAGCTGTTTAAGGTACAGTACACATACCACAAAAAAAGATAA
AAAAATATTTTTAATTTTTTTCCATCGTATAATTATTTAAATATTTGTTCGACCATCCCTGATACTGCAGGGTTTACAAACCTGATGAATAGTTTGGAAG
GAAGAAGTGCTCTTCGTTGTAAAAGGTCTAACTATGTCATGTATACTTAAGCATGTATAATTGTTTTGGTGGGTACTTAAACAGTTTTAAAGTCAACTTA
TAAGAGTTAACATCGACCGGTTTAAAAAAAACTAAATGAATTGGCTGGAAGAGCCTTCCTTTTGTCAGCTTAGCAATTTTCGCCAATATTATTATCTCTT
TTCGTACGTGTCTCGCGATATCCTACGACGCTGCATACCAGTTGAGACTCAAAAGCTGGCGACAGCGGTTACAGGAGAAATACGGCTGACACAAAATTCC
AGCAGACATAGTTGTGCAATTCACAATCGTTACTGTTCAGCCAATCACATTCGTTTATTTGACTTGGTCTTTGTATTCCATATGCTTATGAGTATTTTAT
CAGTCACTTCGTGTATTTATGGTCCATTTAGTGTGTTTTCTGTGGATATATCTTGCGACACGGACAGGGAATTGTCGTACAATTACTATGGAGGATGGCA
TTCAGTGGTGCCGGATTTATCTGTCGTTGTCTAGCGATACATGCTGGTCATCATGGTGATTATGATCAAGGTCTAGCTAGGCCAATCCGATCGCTCGAAT
GCAAGATCTCCGACGACGATTCGCTAGAATAAGTTCTAGACTTTTCGGCGAATGGTAGGACGCCCAAAGACGTGGATATAGCCAATCAGCGCAGATGTCC
TACCTGGCCCATGTCTGACGTTGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTACTCAAAAACGGTTGCTA