Description :
From Genome Similarity Track
Location :
contig_1:213182- 214416
Transcript NameFunction/comments
g72.t1XP_009530825.1 hypothetical protein PHYSODRAFT_246404 [Phytophthora sojae

Sequence
1234 bases(100 bases per row)
CATGCCTTGATGCGTCTATTCCTCAGCGCTCTTTTTCTTCTTGTGCTTTTTCTTCTTGTCCTTCTTGTCATCGTCGGCTTCGGCAGACTTTTTCTTCTTG
TGCTTCTTCTCCTTCTTTTCCTTCTTGACCTTAGGCTCTTCCTCCTCGTCGGTCTCCTCGGCCTTGCGCTTCTTGCTCGACACAGTCATGTCGGCCTCAG
CGTTGTACGTCGTGCTGGTCTCCGTCTTCGTGTACTTCTTGGCCTCGTTCTTGGTCTTGCCGTTGCTATTCGGCACGCCCGAGAAGCCGTTCTCCAGCTG
CCGCACGCGGGCCTCCACCTTGGCGCGGTTGTCGAAACCAATGGTAGCCTCCGTGGCGTCGCCCAGAGCGTCCACACGCACAGCCAGCGCCGTCTTGGCC
GCCAGCACACGTGAGATCTTACCCTTGTGCTTGGGGGCAGTTTGGCCGATCAGCGAAGCGTGGTAGATCAGACCGTACTTGGGGGTATCGTGCTTAGTCT
TGAGAGCACGGAACAGAGCCTTCTCGGCACCAAGGATCTGCACGGTGGAAGCCGGGTGCTTGGCCAAGTTCATCAGACTGCCAGCGTGGGCAATGAGACG
GGCACCCACCAGCTCGCCGACCATGACGGTGAGATTGGGGGCAATGGCGTTCATGCGGTTCTTCAGGTAGTCGAAGAGCTGGGCGCGGTACTCCGTGAGG
GAGATCACCTGCTCGCACAGAGCCGAGATGTTGGTCACGTCCTCCTCGGAGATGTCCGTGCCCATGGAGACCTCGCACACCTCGCGCATGGAGGCCTCGA
CGTCCTCCGACAGGATGTCCGAGAAGTCGAGCTTCTTGACGTTCGAGCGCACGCCCATCTTGAGCACGCACTTGGCGTACTGCAGGTTGTCCGTGACGAT
CTTGCCCATCTCAGGGAAGTGCCAGCCGAACCACTCGCGCACACGCATCGAGTAAGTGTTGATCTCCTTGTCAAGCTCGTCGAGCAGCCCGATGGCCTGC
ACGATCATCGTGTCCACCTTGTCGGCGCTGAACTTGAGTTTGTAGCGCGAGAGCGAGTGCGACAGACCGAGCGTCATGGCCTTGAGGTCGTCGTCCTCCA
GGCCCGTGATGAGCGTGTCCATGTTGGCGCGGATGCCACGCATCACCTCGTTCACGGCGCTGTCGTTCACGCACGCGATGCTGAGCTTCTCCTTGATGAG
GCTGCCGAGCGCCTTGTCCGAAACGGCCAGCTTG