Description :
From Genome Similarity Track
Location :
Scaffold_389:21317- 22849
Transcript NameFunction/comments
Phyke_g9110conserved hypothetical protein
Phyke_g9111hypothetical protein PHYSODRAFT_560503

Sequence
1532 bases(100 bases per row)
CGTCTACCACTTTTTCTAATGACTTGATCGACATCTTCACGCAATTCACTCACGGTCTACTCTGCTGAAAATAAATACTGTAGCAGCTTCAGATAAGACG
TACTAGAAGCAAGCTAATTTTGCCATGAACCAGACGAACCTCTCGAATTAGCGTTCTGGTCGAAGTGACCTAGGTAGCTTATCCACCGCCTTTCAAGAAA
GGAATTTGTAGCTCGTTGCAGTGTAAAAAAATCCTGGTCTGGCGACAGTCGTCGTTCAAGCAAGTTCCAAGGCTCCGTGTTCCGCTCAACATCTCGGCAA
AAACAATGACTCAGTTGGTGAAATTGGCATTGAAGCAAAGCGGTGATGACAATATCGATAGTCTCGGGGTAGAGGAAAATCGCGAGGCCTCTTTACCTGC
AGATGGGGAAGGTGAAGTTGCAGGTGTTGACGACAAGACTGTTATTGTACTCTCGACGGAGGAATTGACACCCGTCCCCGACGTCTCGACTGCAATGATG
GATGAAGTAATCGAAGTTTTGGTGAGCAAGGCGGACTGGCTGCAGCTCTACGATGCAGTCGTGATGTTGCGCCGCATTGTCGTGCACCACAGCGATGTGG
TCACAACTCAACAGGTTGAAGGTTTTCTACGGCCTCTAATGGTAGAATGTGATAGTCTGCGCTCAGCTCCGTCCAAGAACGGCCTGTTGGCATGTGCAGA
GTGCTTCCAGTTTCTACCTCGCTCGATCCTGGAGCGTCCATTTCTCAATAGTGCTCGACCAGAGGTTTtggacgtgctgctgcgtcgctCGACCTGTGAg
aagaagttcttgcgcGATGCCGCTATAATTGCAACGCACCACCTCGCAAAACATCTTGCAGGACTACCGCTTCTAACTGCATGCGCACGATATGGTACCA
ACAAAAATGGCAAGCTATGTGCCACAGCCGCACGAATCATTGCGGCGGGTTTGGCACGTTTACAAGAGCAAGCTGACGCTGGCACTGGAGTCCGTCAGAG
TCTGTGCAGCAAAGGAAACGGATCGTTGCGTGGAGTATATAAAGCTTTAGCAGAATTCCGCGAGAGCAAGGACGCCAACGCACGCTCAGAGGCTACGACG
AGTTTTCGAAGGCTGGGCGAGCTGCTGGGTTCACACGAACTTGAGCTAGGATTAAAAGATGCTTTCCCAGGTGCTAGTCAGACTGGCGTCGTTGCTCGCA
TTCTCAAGGACGCCTCCCCAAAACCCAGCACGAAATCCCGTGCACCACAAACAGGATCACTGCGAGACCGCATGAAAAAACCAATGCTAGGGCAGTAACT
AGGTATGTCAGGTCTAAAGCACGAACACTAATCAAAGCATTCTCACTACTATTGACTGTTTATAAGCTGCAGCCTTGCTGTTCTCTTCAACACAGCGTTA
GCCTCAGTCTTAGGTGTCGACAGGATGCACTCGTTGCGCTTATGCGACGTCAGCGACGCCCATGACGATCTCCCGTCCAAGGTCATCCGAAAGCTTGTCA
CCGCTGATCACGACGACACGGTCGCCCGACGA