Description :
From Genome Similarity Track
Location :
Scaffold_653:21313- 22512
Transcript NameFunction/comments
Phyta_totarag9958hypothetical protein

Sequence
1199 bases(100 bases per row)
CTGCACCTCGATGCCGAAGCCGAGAGCAATGACGTTGGCCCGCTCCGGTGTTATCTGTCCTTGGCGACTCCGAGCTCTCATACTAAGCTGGTGTCGCCGT
AGGAGCCCTGTCTCCAGTGCCACGAGGCTTTAAAGCCTGACATGTCGTACTCGTCAGTAATTTCGAGGGCCTGCATCTCGAGCATGGGCCCGCTCACAGG
TACGCCGTCTTTTCGCAGCATATTTATCCACCCAACGAGCTCTTGCTCGGCGTCCGCAAAGAGGATCGTAGCCACACCAACCTGCCGGGAGTACTCGAGG
TCCGCTGTTTTTGGGTTAGCACACAGCAGCTTAAGCGTTTCGTGGTTTGCTATCCAAGTATAGATTAGCTTGCGCTTTGAGTCTTTCGCTTTAGAACTCA
GTGTGCAAAAATATTTTTCCACCGTCTTCGACATGCGTTTGTTGCACTCGAAATAATACTCGAcaatctgcagcttcaaactATTGGGAGTGCAGTGTGC
ATCTGTGTGTTGGTTTCGTTCGTCCTTGTCCGGTCACACGAGGATGACCTGGTGGCTTGGGCTTGGCCATGATAGGTGTCGAGTGTTTGACTGGATGGAG
TGAATGGCCTCCTTCCAGcacttttttttttaaataccGATTCGTACTTTTGCTGTATCGATCGCTGATTGGCTACATTCAAGGTGTCTGTAAATGACGT
CTGTTGCACATAAGTTATGGTATTGTCGAATCGTTCTTCACAGATGTAAAAAACCGTAATATGGTTTTATTATGGTACGCTGCCAAGGCCGGCGTCCCAT
CGTAGACGAAGCTGGAGGCACTTCTCCTGTCACTTCAGAAAATGCGCTTTGAATGACACCCGAGGACAAACCGCCGCAGTTTCATCCTCACGCTTCCCAC
AATACCATTTACACGCAGGATATTGGATAGACTCACACGACGGAAATGATCTCCAAACCATCGATTATAATAGCTAGGTACAGTACACGGACAACGGCTT
ATGACGCGGCACGAGTGAACATGGGCGGCGGATGGTTGCTCCTTTCCACTTCGTCGGCGATTCACTCGATGCATTGTTGGCGGATATCGTATTTTACAAG
AGAACAGCAACCCAACTGCGCAGCCACCGAACCAATTCCAACAGGTTATCCTGTCTCACAACCCGTGATTGTATTCACGTCCATGTTGGAGCAAGATGA