Description :
From Genome Similarity Track
Location :
Scaffold_128:21310- 22781
Transcript NameFunction/comments
Hyaar_Emoy2810490glucosidase 2 subunit beta putative

Sequence
1471 bases(100 bases per row)
AATCTACGCGTCATATCGCAATCCACGCCCCCTTGCAACAACTCGGCGCAAATGCTGCGCCCTGTACTAGCACTAGCGCTTGCATTGGGCCTTCCCGTCG
TTTCCAGCTCCAGCTCTTCTTCGTCTACTTCGATCCGCGGCGTAGCTCCATCCGACCAGCAAAAGTTTCTGGGCGATGACTTCTTGTGCGTCGTGGGCGG
ACAGTCTCAATATCTGCCAATCAGTCGCGTGAACGACGATTTCTGTGACTGCGACGATGGCAGCGATGAACCCGGCACGGCGGCCTGCTCTTATGTGACA
GCAAGTGAATTTTACTGTGCAAATGACGGATTTTTCTCGAAAAAAGTAGGCTCAATTGATCTTTTGTCATGTTTTGAAAAAAGGTGTTTCTAATTTGTTA
ACATTTTGTGGACTCAGATCCACACGTCTCAGATTTATGACGGAGTCTGTGACTGCTGTGACGGCTCAGACGAGGAAATGGACGGCGTGTCGGTTTGTCC
GAACTCGTGTGCAGCAGCTGCTGAGGCGTTCCGGAAAGATGCGAAGGAGCGTCTTGAAGTGGTTCGTAGCGGGTTTGAGAAGCGTCAAGCGATTGTGGAT
GGAGAAATTGTACCGTATTTTACTCAACTGGGAGAGTCGGAGACGAGTATTGAGAACGATCTGGTGGCGTTGAAGCTGCTAATGGACAGAGTGACGGTGC
ACAAGGAGCGCGAGGAGTTGCGAGAAACGAGATATCGTCTTGAAGTTGCAAGAAAGAAGCAGGAAAATCAGATGGAGAACGGAGATGAGAGAGCAGAAAG
AAGCAACGAGCAGTCGGTGAATGCAGCGGAAGCTGATGATGATGATGCAGCAGTGGAGTTTGAAACACTTGATGCTACACTACTGGCCGACGATGATGCG
CCTATCGATCTAGCAGAAGACCTACGCGCGCTTGAGGTGTTGGACTCGAGTGGGCAGAGTATCAAGAGCCTGGTTGAGTTGCCGGGCGGCACGAGAGTTT
CTCTGGCGGACTACTTGCGCATGGACCACAAAATTCAAGCCCCTACCAAGAAATTGTGCGCGCTTGCATGAATGTAGACGAGCGGGGGTTTTGTTTCCTG
ATGCAGTTCGGTATTTGATGTCTGTGATCAGGTGGACTTTACGGAAGGAAGGAGAATCGTGGCAAGAAGTTTTTCTAGGGTATATTATCAGTGGAGAAGC
TGAAGGTCGAAAGCGGATTGGACTTGCTGTGCTGCGAGTTCTCGGTACGAATATCTCGCACTTATATCGAACCGATCGTTGGGAGAAGTCACTAACTGTA
CGTGCATGCTGTGAAGGCATTATTGTCTCCCCTCTTCGTGCACTCGCAGAGTTGATTCTGTATAGCCCACGCGTGTTATGGCGTTTGTTATCAACTCCTG
AAATCGCCGGCCCAGTTATTGACAAGTTTCCGAACATGCCGTCTCCGTCGCAATCAGCCTGGTTTCGTCGA