Description :
From Genome Similarity Track
Location :
contig_87:2131- 3493
Sequence
1362 bases(100 bases per row)
GCTGATAATCATCTCCCTGATCGGCTCGTTGAGAGTCATTCAATTCGCCGAGTTTTGGAGCTGTTGTGCCCGGGGGTATCGGATATTCTTCCTTCTCGCC
GTACTTTAGGCAAATGTGTTCTACAATACCATGCTAATCGGTGCAAGGATTTGGATAAAGAAGCGCTCAACTCTGTGGTGACAACAACAGAGGGCTGGAT
CAACCTACTTTCAGACGCGTGGATGAATATTTGTAAGGAACACTTGCTAGGCTGCCAGCTTTCGCTTTTGGAGTTTTACTCACATACGCGCTACTACCCG
CTGGAGATGAATATCATGGAGTAACAATTGCCAAGCAGCTCGAACAACTACTGGAGCAAGTTCAGCAAGTGCAGTGACGCGTTGGAGCAATCGTCATTGA
TAACGCAAGGCAATCTGCACGCACTCGTCGAATATTGACAATTCACTGGTCGCACATAGTTTTTCTTTTTTGTTTCGCCCACGATGTCAATAACTTTGTC
AAGGCTGTATTGCGACCTTCGTTTAAAGTTGTGACAGCCCGAGCGTCAACAGCAGTCAAAAATGTGAACATTTCGTCTAGTGAATGGCTATGGCGAGCAC
GCCAAATGAAGAAGAAATGCTACGAAAACAACCTTGGCACTACAAATCTGTGAATCGAGAGGGAACTCGATGCAAGGCTGTTTCCCATCTTTGTTGCGCG
TACAGTCAGTATTGCAAATGTTCTACCGCCGGTACAAGAGATACGAAGAATTTCCACTGCATTTACGAGCTTTTTGGTGATCTCCTGTTTTGGGATGAGC
TCAAGGAAGCGGAAGCCGTTATCATACCACTGGCTTACGCATCGTACAGGCTACAGAAAGACGAGAATACGGTTGGAGATGTCGTACTTTCATTTCGCGA
CATTCACAATGGATTTCAGCAACATATCACTTGTCGTGATACACTGGTGGGTTGTATCGAGTCTCGTTGGGCACAGTGCGAGCAACCGTTTTTCATGCTG
GGTTTGCGCTGCATCCTTTGTACGCCGAAATCGCGAGGAAAATGCCCCATACTTCCGTGTCTGGTATTGGTGTGCTGTGCAAGATTGCGGTTAACAACTA
CCGCCGGCTGTTCGCTACAGAGGGTATCGGCCAGATACGGCGTGATATGTTAGCTTGGATGAAAGGACACTTTACGCGAACGAAACCGAGTGAGTTCATT
GGTGCTACCTGAGAATACTGGGAGAGTGTTGCAGCCGAACGACCACAGAGCTTCCTCCCGAAACTCGCCGTGAGAGTGCTCTCAATTGCTGTAAATACGG
CCACGTGTGAGCGATGTTTTAGTGACCTTGGATCAATCCACACACCAAAGCGCAATCAAATG