Description :
From Genome Similarity Track
Location :
Scaffold_144:21305- 26416
Sequence
5111 bases(100 bases per row)
ATTGACATCTCCACGTACAGAGGAGTCGAAGAAGACTCCCTGTTGAAATGTTCGTCGAGTCAGACGATTCCATAAGGACTCGGAACATCGTTAATGAGCA
AATGCAAGTCGCATTGGCTCAGTCGAACTTGGCAGGACGTTCCAAAACTTGGGCACTAAGTCTCAAGTTGCACGACCCATACGTGTTTGGGTCGTTGGAG
GTCTTCCAGGCCCGGCTCAGACAAACGTTTGAACCGCCACGGGCTGAGTTCAGGGCTTGATCAGAGCTCCTAAAGCTCAAGCAGGATAAGCGTGATGTGC
ACGCTTACGCCCAACACATACGACTCCTTGCGAGTTGTATCACGGCCAACCCGTTCCATGAACACACGTTGATTATGGTGTTCATGCAGGGTCTTGTGGA
TGGTCTTGTCAAGATCCACCTGTTCCGCTTGTAACTGAATTCGCTAGAAGAAGCGATATCGGTTGCGGAACAGGAAGACTTTAGCTTGAGACAGGCTCAT
GCTAGTTCGGGTTCATATCGTCCCCCAAGACGACAAAAGTCGGAGGTACAGGACCTATGGACCTCTGTTATACTGAGAGCGAGAGACCTCGCTCTTCAAA
TAACAAGCGATTGCAGAGATGCAATCGCTGTCAGAAACTAGGACACTTTGCCTACGAGTGTAGTGCCCTACAACCAGTGTATCGAAGCACTGAGTGAACC
CATCGACCGTCCGCCAAGAAGGGCAACGGACGCGGGTCCAGTGTTGTTGCGATTTTGCAACAACGAAATGAAACGTCAAATAACGGTCAGGGTTAATAGG
AGCGGAGCGCCCTACCGATCCAGCGACTTCAAGAGAATTCGCAAATATCTTGATGAAAATTACTCCAGACTCACAATCACTATGTGTCTCTGCACTTGGT
GATGTGGTACCCCTCCAACTTCAAGGTGACGACCTTGAAGTTGGAAGTGACAAGAGATGTAACTTCATGACCTAGAAGACTGTGGGGCGTCGAACAACTT
TGTTCATCGCCAGTCGCCAGAGGGTCGTTGGCTCAAGTTCGTTGAGCGCGACATCCCTCCAACATGGATGACGGTGCGCCTAGCAACAGGCGCATCGATA
ACATTGATGAAACGTGTAGTGGGAATTGACTACACGCTGGAAGATTTGCAGTGCGATGATGATTTCATCGTACTGGATTTGGATGACAAGTTTTCTGTCA
TCATAGGCTTACATTGGCTCAGATCATACGAGCTAAGGGTCAGCTAGAAGCATCTAACCGTGAAGATGCCTGCCACTTGTTCATCATATGGCCATCTGGT
GAACGTCTTGGATCGTCCACAAGCGTGTGGATGTACTTCGATTGAGTACGATGGTCTCACTTGTGGTACGGTCGTTACTACGACTGCACAAGGTCACAGT
GAGACGACCAATCACACTGTGGAGGAAGCTGCCGGTGGCTGTGCGGGTGCACAGGTAGTGCCGAAGGTCCACCACTCGAACAAGTCGAGTGGATCGGGAC
ATGGGTGTATACCTAGCTGGCGACATCGAAGTATTAATAAACTGGTTGCCCACAAAGGGCAACACGATGATCTTAGATAGACCGGAGAGTCGATCATAGA
GGACCTGGATGTGGTAGCGCAGCCACAGCTAGAAGACGTCGAGAAAATGAGTCCCCACGTACTTGATAAACAAACCCCTCAATCAGATACTGTTGAGGCA
ACAAGACCTCACCAACCTGATGGAATAGGTCCCCAGAAGCCTGTGTAAATAGGTTCCCAGGATGAAACCTAGATATTGAATGTCTTGGTTAATGATGGGT
CAAGTATAGGCGCTTATACACTTGATCTGATCGCGCCTCCGAAGTCAACTTCGGAGATCACTTAGCTACCTACGCTAGAACCAAAACATTCTTGTGAGAT
CTGCTCAGTGGCAAGGTCAAATAGATCTACGTACTCGTCGCAGAGGACGAGTACGTGACCGATATTCGGCCGGCAGTAGTATTCGCCGAGAACGAACGGG
TTCTCAGCAGCTCATCGATGGACGAATGTGTCCTCAATGAGAAGACTCGGATTGAGCGATATACGTCTCAATCTTGTGAGTCACTTCAGCCAAATCCTTT
GTATGAGGATTTGATCGAATCCAGAGATGTGTTCCCTGAATCCGTACCATGCGAGTTGCCTAAGGATAAAGGCACTCGACATGGAATCGAGCTCAAACCG
GGATCGACGTATTGTGTCATGAAGCAGTGGCTACTGCCTCGTCAACAAGTACTTGCGATTGACAAGTTCTTTGCCGATCGCTTTGCAGCGAGCCATGTGA
GGGAGTCAACCTCCCCACATAGCTCTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGAATGGCGGATAGTGCATGCATTCAACAAGATTAATGCTGCAAC
GGTACCGGAGCAGGCGCCGATACCGAGGAAGGACGTCATCATAGATGGTACGGCGAAGAGTACCATCTTTTCGTCCATGGATCTGATGGATGGATTCTAT
CAGATCCATATGCATGAACGAGACGTCCCGTTCACAGCAGTAAGCACCCCCAGCAGTATACTCTGGAAATGGCTTGTTATGCCACAAGGGATTGGTAATC
CCCCAGCCACATTCAACAAATGCGTCACAAATCTGTTGAGACCGGTGCGAGAATTTGCACCGAGCTACTTTGACGATGTCTTCGTCCATATCCGGGATAT
GGGCGGAAAGACGGACGTAGAAGTTCATAGAACACACGATCGTCAGGTCCTTACACTCATGCGAAATCATAAGTTGTACGCCAACCTCAAGAAGTGTATA
TTCGCTGCGAGCAGAATACCACTTCTTGGGGCATCGTGGGTAAACACGGGGTACGCCCTGATCCAGAAAAGATTGAGGCGGTTACCGACTGGACTGTGCC
AGACGACATTAAGGGCCTAAAAAAGTTCCTTGGTCTAGCGGCGTACTAACACAAGTACTCGCGCAACTATGCCGAGATGACCGGTCACCTCTCTCGTCTT
TTGAAAAAGAACGAGAAGTGGTGATGGGACGCTGATTGTCAGCGTTCCTTTGAAGGTATCAAGCAGAGCTAAATGCAATCGCCCATCTTGGCGATTGCAG
ACAAAGACCGATAATTCCATGTGGTCTGTGACGCCAGAGGTTTCGCAATAGCCTGCGCGTTAATGCAGTACGATGCCGATAGCGCAGAGCGCGTCGTCTG
TCATCAATCGCGTCAGCTGCAAGCAGCTGAGCGTAATTATTCAGTGTATGACAAGGAACTCCTTGCCATGGAGTATGCACTGGCGAAGTTTCGTGTCTAT
CGTTTTGGATATAGGCCGTTTGTAGTCTATACAGACCATGCGCAATTACGCACGGCCGTAAACAGTCCACACCTCTCGCAAAGGATGGCGAGGTGGCTGT
CCTTCTTTGCGGAGTACAACTTCTCCGTGGAGTACAAACCCGGACAACTTAATGTCGTCGCGGACGCGTTGTCTCGCCGACCCAATTTCGAGTCGGCGAC
TCAGTGAGGTTGATATACTGTTGAAACACTAGTTACTTGTGTCCCGTCGTCAACATTGCTTGACGACATAAAAAAGGCCTACGCAGAAGATAAGGCTCTT
GTGCGACTGATGGATCATCGGGTGAATCTATCTTGCAAATATCTCGAAGATTTACTAGCCTTGTATCGATCTTCCGCGGATACACAACACGAAACGGGTT
GCTGTATTATACAGCCGTTACCGGCGACAAACCTCGTGTCGTCGTCCTCACTCATAATGATTCGCTGTTACGCATCATGTATGAAGCCACGATGCACCAC
CTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCACGGTAAATCGCGACTTTTACTGGCCCCGCCAGTATCAGTTTGTGCGCAATTACATTCGTGCTTG
TGAAGTGTGCCAACGGTTGAAGCCCAGTCCTTCATCCCGTGCGCCACTGCAGCCTCTACCAATCCCGGCAGAGTGCTGGCAGTCCGTTTTAATGGACTTC
GGCTTCGGTTTCCCCGAAGACGCTCACAAGAATAATGGTATTCTTGTGTTCGTAGACCGATTCAGCAAGATGGTACATCTTGATGCAGTTAATGTGTCAA
TATCAGCACATGGTTGTGCCCGTGTCTTCATTGACACGGTATTCCGACTCCACGGTCTACCCCGTGAACTAGTCTCTGATAGAGATTCTCGGTTCACGGC
GACGTTTTGGCAATCCGTGTTTCGATCCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTGACGGTCCGACAGAACGCGTCAACCGC
GTCCTTGAAGAGATACTTCGAGGATACTTCCAATCTTTCACAGATTAGAGCGAATTTTTGCCGATGGTGGAGTTTGCAATCAACAACTCCGTGCATACAT
CGACAACGCATACACCATTTTTTGTGAACAGCTTACGCCATCCACGCCTACCCACCCATTTAGAGTGTGACACTAATTCAAGGCGCGAAAGATTCGCTCG
AGCCAAAACCGTACTGGCTCTTGCTCTTCACGTGTCGAGGTAATCGATGACGCGAACGCTTCCGATGTCGATCAAATCGACATCGAAGCTGGTGATCTCA
GCGATAGTGACAACGCTATTGCTAACCCAGATGAGGATGACGATGCTGGTATATTCAACATTGCCAATGAATACACCAGCGAGGATGAGAACACCCTCGC
TGAAAAAGAGGATGACCTCCTAGCGGTGCGCACAAGACGCACTGCAACAAACCAAAGTGAGTCAGCAGAAGATTTCCTGCTGGAACGAGAAACAGTGGTT
CGTTTCGTGCAAGAATCCATCGCTAAAGCGGTGAACCAGCAGAAACGGAACGCTGACAAACATGGAAGAGCAAACGTTCATCTATTTAATGTTGAAGACA
TATTCCTACTGTCTACGGTAAATCTACCTCAGCACGCAGTAACTAATGTGGGTACTAGTAAACTACTACCCAAGTACATCGGCCCGTTCCGTGTACTACA
TCGCAAAGACAATGTGTACACGATAGAGTTGTCTCGCAGGATGGTACGCATCCTACGTCTTATGTCGGTCGTCTCCGCTCGTACCATCATCACAAAGTCT
CTTCCTCGGGT