Description :
From Genome Similarity Track
Location :
Scaffold_14:2130- 3919
Transcript NameFunction/comments
Phyke_g976hypothetical protein

Sequence
1789 bases(100 bases per row)
CCCACTCCCGCGCTGCCGTTGAAGCGATTGCAACGtcgttcttcatcttcgatTTTGGGTTGCACCTGTTTGTTGCCCCGGACCCTGGGAAATACGTCTT
CTCGGCTCATGGGATGATTGACCTGGTGACTATTATCCCGTCATTGATTGTGGTAAGCCTCGCGGAAGTTTTTCCCAGCCAACTGGAAAGGGTGAAAGCT
TAACAGACCTTGAACCTTCATTGCTTTCGTAGTTTGTTGACCCGAACAGCCGTTCCAGCCTAATGTTCGTGTTTCGAGTGCTCCGTATTTGTCGCGCTCT
GCGCGTGTTGCGGTTGGCTCATTACGTTCAATTTAAGAAGCATGGGTTCGAGTACGAGGTGAGTGCCGCGTTTGACCGTATTTGCGTTGAAATGTCAATG
ATATACATATACCTTATGAAATGGTTGGTGTCTCATAGCTCGGAGTTTTCATTTTGTCGGCTATTGCCGTCATTCTGTGCGCGGCGGGGGTCTATCAAGC
TCTCGAGGTTGAACAGTACGACGAACACCAAAAACTCCAGTTTCACGATGCACTATATTTTGTATTAGTGACCGTTTCGACGATAGGTAAAACATTGTTT
GGTTCTACATAGTGTCGAGATACGAGATGGTCATCATTCTTATGACACTTGTGTTTCTTTAGGATATGGAGATATCACTCCTCGTACCGAACTGGGTCAT
GTGTTCGTGATTGTTGTCATTATCGGAATCTTCACGATCGTCCCTGCTGAAGTGAACAAGCTTAATTTGTtggcaaaacaaaacaattCGTGGGACAAAG
ATGTTACTGTGAAATCGTCCGGGCACGTCATCGTCTCCGGGTACAACTTGACTGTTAGTACCGTGCTAGAATTTCTTCAAGAGTTTTATCACCCGAGTCG
GGGGGTCATCCATTTGGACGTGGTTTTTGTCAGCGATGAACTTCCATCACCAGAGATAATTTCTATTCTGGCAAAGCGAAAATATCGCCGGCGAACAAGC
TATATGCGCGGCAGTTTAATGGTAGGGCGGGATCAACTTCGTGCTaagatggagacagcaacCGCAGTATTTTTCTTGGCCAATAATCGTCACGAACCCG
CACAGCAAGACGCAGCTACTATTTTGCACGCGGTCTCTATCAGAAACTACGCAGACAGCTGCGGGAAGCACGTGGATATCTACGTACAGCTCCTTTCGCG
TGCATATGACTACGAGATGGCGTCAGTGTTACTTAGAGCGAATGCAACGAAGACATCTTCGCTGAAAGATATGCTGCTTGCTCGTGCATCTGTGTGCCCT
GGGTCCAGCACGCTCATTTTAAATTTGATCCGGTCGTATCACTTGGGACAATACATCAAGCGACGTACATGGGGTAAGATGTGGATTCACGAGGTACGAA
AGTAACCTGCACCAAGTGTGGTTAATGCGTTCATACTTATAATTTCGTGTGGTCAATGCTGCAGTATCTGGATGGAATGACCTATCAAGTGTTCCCTATC
ATGTTTTCGACCCGATTTGACCGTCGCAAATTCGACGTCGTAGCTCGTCACATATACGAAAAATATGGTGTGCTGCTTGTCTCCGTCTTAAGCGCAAAGG
AAAACCGTGACCCAGGCGTAAATTTTGACAGCACACCTGGCAATCCAATTCAGCTTACCCCCTTTGGGTCACTCATCCGTGAAGGGTACGTACGAAAAAA
AAATGTAAAGCTCTGTTTCATCTGTACTAACTTGCAATCTGCTTGAATGCTCATGATAGGGATATTGGTTTCGTGATCGCAAAGACAGC