Description :
From Genome Similarity Track
Location :
Scaffold_68:2130- 3572
Sequence
1442 bases(100 bases per row)
GCAGTGTACACATGGGGCTCTGGGTCGCTCGGTCAACTCGGCCATGGCGCGTTCGTCAAGTCGGGCATGCGCAATGCGTACGAGGAGCTGTCGCCGAAGC
TTGTGGAAGCGTTCGAAGGCAAGAGCATCGTCAAGCTCGAGTTTGGCGCCACGCACAGCGCAGCGAGTGAGTTGAATGCGCTGCTGAGACTATGAAATAT
GGTGCTCTTTGTGGCTCGCTACGTAATATGGTGCTCACTATGTGGTGTATCTACTTTGAACAGTCGATGACAAGGGCCGGGTGTACATGTGGGGCTCGAA
CGAATACAACAAGCTCGGCCTGGGTCCAGGTACGGGCGACTTTGAGTCCCTCCCACACCTCATGGAAGCCTTCGAGGGCATCGAGATCGTCGACATCTCC
TGCGGCGACTACTACACGGCGGCGGTCGACAAGGACGGCAAGATGTACTCGTGGGGCTGGGGCGGCTCGACCATGAAGGGCGCAGGTGGACTCGGCCACG
CCGGCGGCAAGGACGAGCCAACGCCTCGTCTTCTGCGTTCGCTCGTGGACCAGGGTGTGCCCATCGCGTCTGTCGAATGTGGCGAGTTCCACACGGTCGC
GCTGTCCAAGGACGGCGAGATCTGGGCGTGGGGCAACGGCGAGTACGGACGTCTGGGCAACGGCGAGACCGACACGTTCGAAGTGCCGGAGCCGATCGAG
TTCTTTGCAGACGAAAACGTCGTGTCGATCTCCGCCGGTCGCGACTTCACGTTCGCGCTCACGGACAACGGCGAGCTCTACGGCTGGGGCGGCAATAGCC
GTAAGTAGCTGCGCAATATGATGAACCATAAAGAATGCATGTAAGACTAGCTCACCATGTCCTTGTATCACTCATTATGTAGACAACCAGCTCGGTGTGG
GTGGCGGCTTGACGATGGACCACTACAACATGGAGGCGATCCCGACGCTCGTCGAGGGCTTCAACGGCGTGAGCATCAAGCAGTTCGCGGCGGGCTACGA
CCACGCGGCCGCGGTCACGGACGACGGCCGCATGTACATGTGGGGCTCCAAGCTTTGGCTCGAGCCGCACGAGATGACGGCGCTCGAGGGCGAGAAGATT
GTGCAGGTCGCGTGCGGTCGCGTGTATACGGTCGCGCTCTCGGAGGACGGCAAGGTGTTCACGTTCGGCAAGGGCAGCTCGAACTGCCTCGGCCACGGCG
ACCGCAAGAACCAGCTGCAACCGATGCAGATCCAGTCGCTCGCCAACATCAACATCGTCTCGTACGTATTATTCTATTCATTCCTTACCTGTCGGATATG
AGAATTGATGATAGTTGATGACTAACCTTGATGTTGTACTTGCATGATGGAATGGCAGGGTCTCTTGTGGGGACTACCACATGGGGGCGATCTCGACACC
GCACTCGCAAGCCATGGACAAGGACTTTTCGTTCCGCGAATA