Description :
From Genome Similarity Track
Location :
Scaffold_1484:213- 4295
Transcript NameFunction/comments
Phypl_g13526hypothetical protein PHYSODRAFT_354940
Phypl_g13527hypothetical protein

Sequence
4082 bases(100 bases per row)
TGCATtgccgaggccgcggcgAGGCCTGTCGAATGCAGTTGCCGTCGGAAGCGCGCGGGGCGGGACGCTTACGGTTCAACCGCGGCCTGATATTCCAACT
CAGGCGGCGCCATGGCGAGGTCTTGGCAAGCTTCAAACCTGTAGCTGCCGCGGCAGTAGGCTGCGAAGAGCTCGCTCCGAGATGACCCTAGATGCTAAGC
TTCGACGCGTCGCCCCCGCGCCTTAGCGCCCAGATCGCGGCGCTGAACCCACGCCCGTTTTGGCAATAGCacgccagccagcgccaagATATCGCAATGG
CAGTACGCCATTGCAcactgctcgcgctcggctcACGGCTCTCGGTGATGGTTTAGGCCGCTGCAACACCGGGCCTTGAACTTTGGGCCtgaggaggctg
ctgccggcggGCAACCGCTCGAAGCAtagcggcggccacgagcaccCAAGAAGGCAGAGAGCCGAGCGGAGCAGttggcgaggaagagcgctTCACGCCG
GCCGCGAGCGCaagccgctcgcgctcgttTCCTGGCACTCACGCTCACGCCCACGACGCAGCGTGCCGGCGCAGCGGAGGACATGGCAGCCGCCAAGCAA
GCGTGATGCCGGCTCGGGCGTTTCCAGCGGGAAAAAGGCGCGGCGCGCCCTTTTTTCGGGGCTACCATGACATTTCGCCTGCAAAATTCACCCCAGCAGT
AGCGTtaccagcggcagcagcctgcgCCGCGGCAGCCGCGTGGCGGGCGACTATCCGCCGCTGTTACTCACCGCGCCTTGGTCAACTCGTAGGGGCGCCA
GTGGCCTGGATATCTCGGCAGTGCTGTCAAGGCGATGCGCTCCAGGCTGgagtccagcgccttgggATCAGAGTGAGCGCCGCTGGTTTCTGCGCGGCTC
GCTCTTGGCGCCAGTATGGGGGGCGCCAGCCAATGGGCGTGTCTGCCCATCTTTCCTGTTGTGATATTTGCCAGGAAAATCGCCCATCCCGCCGAATTTA
GAAGGGAACAAGTTGGCGTGGCGCACTCCACGCACCGAGCCTCGCGCACTAGCCCAGCGCCGGGCCAGTCCATTCGCCATCTTGCTGGCCACGACTCACT
CACTCAGACAGAGCCCCGTGGTAGCCCCGGTCCgttccgccgccgccagtcCAGACAGGGAAGCACCGATCCGCGCCGCAGAGCCAGACgcagcgcggcc
gcgcagTCAGAGCACAGGGAGTGCCAGGGAGAGAGCTAGGAGAAGCAACGTAGAGCAGGGAtggagatcgccaagaacGTGCGCGACTTCCTGGTCGGca
tgaaggaggcgctgTCCCCCGAGGAGGAccagctgctgtcgagcctgcagacgctgcacgagcagtACCTCAACATCATGGAGGACTTCTCGGTGCAGGT
GTCCGCCCAGGCGCTGAGCATGAGCCCCGAGGCGCGCGTGAATGCGCACCAACTGCGCCTCAAGATCTATCAGGACTGGCGCGCCAAGTTGATGGAGCGC
GTGTTCGACAACTCCAAGGAGATCGCGTCGGCCGAAGACGCGGAGACGCACGAGCCCGGGTGCGACTGCTGTTTCtgcgagctcgcgctgcggctgAGCA
GCTACGAGACCGTGACGGCCGACTACATCCAAGCGAGCACCCGGATCAAGAACCCGGAGAACGACGCCGGCGAAGACagcgtcttccagctgccGGACTT
CCTGACCACCTAGGCGTCGCATGGCCAAGCACGCCAAGCTAGTTAGGGATTTCTCGGCAAGCGAGTGCGCCGGGAACGCCCGCGGATCTCGTGTGGAACG
AAGAGAAGGACTGCATCGCGAGATGGGACCGCCCCCGCGCCTCGGGGAGGCTGCCGAGCAGTACAATACGTGGAACtactacaacaacaacaacaagagG
CGCTCGCGCGGCGCCGCGATCGTGGAAGTCGCGGCCGCCCCGGCGCGGGCGAGTGGGTGTGTGGAACAATAGAGTGCGCCGactgcgtcttcgccgtcac
cggaAGCGCGTGCATTACAGTCGGTAGTGGTATTATGACCCCCCGCCTCGGTGCGCAGGTTTATAAGCAAGTTTATAAGTACAAAGGGCTCGTTTGAATC
GTTCGCTAGTAGCGCGCAGTGCGCGGGCAGAGGGGAGGAGGGATcgacaccagcaccgccgcacGCCCCGCTCTGCCGCTGCACACGCGCCAGCGCAGGA
GGAAACGAGGCGAGCCAAGCAGAAGAGTACGCGCGCGTGCGAATAACTCGCCGAGAATGCAGAGAGCTTCAGACAGTTCGTTCGTTGTTGtggttggtgt
tgttgcAGTGCTTTACCTCGCCGGGCATTCTCCGTGGGCCAAAAAGTATCATTTCTGCGGTGCCGACCGCCAGCGTGGCCCGCTGAAGCCAGCGGCCGAG
GTTGCCACATGGCCTGCCACGTTGCGAGCGGTGAAACCGCGGCTGGCCATTTCGACGTGCTGGGCCCAGCACGCCGGCGCGCCGTCGAGAGCGGCGCCAA
GGTACATTATCCCGGGGGCCGCCACTGGCGGCGCCACTGCGTCGCACGCGGCCGCCTGGCGGGAGCCGCGCTCAGAAGACCGAGCGGCCCGTACAGTCTT
TGGCTTGGACGGGCTGGCGTTGCACATACGCCAGCTTGGAGCTCGGCGGATGACCTCGATTTGCGCAAAGAAGCGTATGGTTCGATTCGAAGCGCAAAAA
TTGGGCTTCAGCGGAGCCTGCGAGATCGCATGCGTCTTTGGGTACGGATATATACGGTATCGCAGTTGTATCAGGACccgcagcactcgacgaGTACAAA
CCTAGCCGCGCGACCCCGACGTGCGCTTATAGCGGTATATCTGATTTCGCAGACATCAGGTTTGGCAGTCGTCGCGGGCCGTTGAATTTCCAAGTGCGAA
AATGATGCGAAAAGTCTGGGTTCTCCTTGATACTTGCCGACCAGCGGAAGACGTGAAGCCGTTTCGTGTCAAGCGCTCTTCAACGAGTAAGTACAcgtac
gtacatgtacttggcTGCGCACTGCACACACTTTGGGCCCGACGCTGCTTGGCGCCGCAGGTATCAGTGCCTCCAAAGAGCGGGCGGCCCTCTTTGAGGC
CGTTCGTCCACCAAGAAGCCTCACGGCCGTGCGCGCGAGGCTTCTTGGTGCGCGATGTCCTCCAGTTGTTGCCCTTCTCTGCCTCGCGGGTTGCAGTCGG
CGACTGCAGTCGCCAGCGTGGCCGCTGGCGGTCGGTCCAAGCGCAGCGGCAGGGCCCCGGTTTCGCCAATACCACTCGGTGACCGCAAGTGACTCTTTCC
TGCGAGCATTGCAGCAATTGAGTGAGTCAAGCTTGCCAAtccggcggcgtcgctgaagaagacggagtCTGCGTCCGCCGGCTGGCGCGGGCCTGTCCAC
CGTACGGTGCACGCTGGTCTGACTGCGTCTGCAGACTCTGCACTCGCACGATCCTCCGTATCGTTATCATGCCGCTCGGGCTCGGAAAGAGATTCTGCTC
CGTGCAGTGCTCCAAGATGGAAAGCCGGACGGGCTCCCGACTTGATTCGAGACTCGCCGCGACTTTCCAAGGCGAGCAGCGTTGGGGGCGCCACATGACC
GGCAGCAGGCGCCACAGCCCGATTCGTGACAGCGCATTGCGGAGATATCGCATCTGCTTGCAGCAAGCTTTCCCTTGCCGGGTCGCCGCCCTGCCGGCGA
GCAGATAAAGGCCAGCAGTACATTGCTGACGAGCTCAGCACCATTTTCGTAGTCGCGACTTTTCAAGGCAACATTCTGATTAGCATGGCCGGCGAAATGT
GACGACAACCGGGACTTTCTGTTGCGGAGATGGCATGTGATGGAGCGAGCCTCGTTTGCCTCGCGCGACGCCGTAGCACAATCAAACGGCGACGCACGCG
CGCCAGCCACGTCCTGCCGGCGCTTCTGCGCGGAATAGCGGCAACGCTGTGTGAGTCAAGGCGGCGACAAAGCGTTGTTGCGCTTAGTCACCACGGCGCG
TGTCCGCCACGTCGAAGTGCCCAGCACCATCTGCAGTGGCGACCGCAGGCAACCAGACGAGGAACGCCACGCGAGACTTCTG