Description :
From Genome Similarity Track
Location :
Scaffold_211:213- 4143
Transcript NameFunction/comments
Physo_144608hypothetical protein

Sequence
3930 bases(100 bases per row)
TCTTGATGAGCTTGATCGACGTCTCTCACGGCAGCGGTGGCTTGGTCTCTCGCGGTATCTCGGGCGGTGCACATCAGATCCAGCTCCTCATTTACCCGGT
GGAGGGCAGCTTGCAGTTGATCCAGGGAGGGCGTGGGTCCAGTGGGAGGCGTCGGGGTCGGAACGGCCGGAGTGGCCGCAGCCGCAACGTGACCTCGCTG
GGCCACGGTGGCTTCGGCCACCTGAAGGGCAGTCTGGACCCGATCGAGGCTGCCGCGCGTAAGGTATAGCTCGTGGTTCACCTCGTCTAGTTCGCGCTCT
TGCCCAGAAACCTGCGATCGGAGGTCCGAAATGTCCGCCGCGGCGAGATCGAGCTGGTGGTCCAGTCGATCACGATCGACGTTAGCAGTCGCGAGATGGG
CCTGAGCGCGTGTCAGTTGGCGATCCCGATCCTGGATCTCGGCGGCTTGCAGGGCTATCTGATCCCGGAGGCCATGGATCAGCTGTGGACCCTGACCCTG
GGCACTCTGTTGAAGGTCACTGACTTCCGTCTGAAGGCGGCGGATCTCTTCCTCTTGCGGCCAGCGGTGGCGCTCCAAGTCGTGCAGGTTCGCAGTCAGC
TCGCGCACGGTGTCGTCCTGGCGCGCCCGGTCGCGGATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTATGAACAGCAGCACT
CCAGCTGCGAACAAGGTGCTCGGCAGAATGCTCGAGCAGATGGTGGAGTCGAGCGAGTGGATATGGCAGTTCAATCCCGAGATGACGCGTCAAGCGACTT
GGGCTGAGCTGAAGGAGGAGTTGCAACACCCCGTTGAGTCGACCTCAGTCACCCAGGTGGCCGAGGACACGGTGTCCCTCCTACGAGCGATGGGCTGCGA
GCCAAGAACTCGCCCGTCCGAAGTCTTGATCAAGAGTTGGACGCCGGGGCTCGCCGGCAAGGAGTTGCATAAGTGGAAGAGGAAGCTTCGCCTGAGCTTC
GGGGAGTCGGACCTGACTCTGGGACGCCCCCCGAGTGCTCGCCCCGCGAGGTAGCAAGCTGATCCTTCGAAGATCCCACTGCCACAGACACCCAAGAAGT
CCGCCAAGCGGTCAAACCAAAGCCAAGCGACGGACGGAATGTTCTCCGCCAAGACCGAAGGTTCGCCGTACTTCCAAGACTCGCACATGGCGACTCCTAG
GTCGGCGAGTCGAGCCGACCGTATTGCGCGTGAGTCCGAAGGTTCGCAACGCGAGCGGAGCACGCAAGGAAACTCCACGCGACGCCCAAGCCGCCGGTTT
ACACCGCGCGACGACTCCTCGTCCGACGAGGACGACAATGACAACATCGACTATGAAGATGGGTTTGACAGCCCGAGCGATGAGTTGGCCCGTCAAGTGC
GTGAAGTGAGCGAGATGGAGCGACTGAGTTCGACTCCTCGGCTCGAGATCGCCACACACCGGCCGCTCGCGCAGATCAAGAATTTCTCAGGAGCCCGCAA
TCGGAGTGAAAACTCTATGCAGTGGCTCCGAGCTTTCGTCTATGAGAGGAAGGGAACGCACACTCCGCCAAACGAGTGGTGCATGGCTTTCGAGCTGAGC
CTTCGGGACGGTGCCCTTCACTGGTACCGTCAACTCCCGAAGAGGACTAAGCGTCAGTGGAAGCGACTGAGCGATGCGTTTATCAAGTATTACTGCTCGC
AGTTTAGCCAGTCTGCGAAGGCTCGCTACTACTCTGTGAAGCGCGAGTCCTCGGAACACCTTTGTGACTACCTCAACCGACGGAATGGTTACGCTCGTAA
TGCTGGCCTTCAGTTCGAGAGTGGTGGTCGCGATGCGAAGGACCATGTGCAGAGGTTCCTCGAGACGTGCGGTGACCGAAGCCTCGAAATCCGGCTTTAC
CACGTCCGGATGAAGGACATTCACGAACTCGAGGACATGATCAACGACATCTTGAAGTCTGAAGAGCGTGGGCAGTCGCGCGAGACCTCGTCTCACCACT
CGCGCAGTCGAGACCAACCGCGTCGTCGTGATGACCGTCGCCACGAAGCTTCGCGTGACAGTTACCGTCGCGACCGCGACCGTGGTTACGAACGTCGCCG
TGAAGACTCTCGCCGCCGCGAAGACTCGCG