Description :
From Genome Similarity Track
Location :
Scaffold_2140:213- 2716
Sequence
2503 bases(100 bases per row)
CCACATGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCCGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGT
GAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTC
CGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGCGCAAGTCATTCAGATCCACCGCGTAATCCGTA
GCGATAATGCTGTAGGGTTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTG
CTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCAC
CTGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCA
CATTGATTCCGTAAAGCGGCGCTGGCCAATCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGA
TCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAG
CCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCACATAAGTGGATCTGGCC
CGTACAACTTCTCATCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGAT
CCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGG
AGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGCCCC
AAACGTCCTTGTAACCCGGCCAACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATATTCCCACCAGCAGGTTGTAATTCAGAT
CCAACACGCGCAGGAGCGCGATTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGAT
CCCCTCATGTTCTTGTACCAGAGCTGTTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGC
GTGGTCGCGATCCTGTTCCTCAGTTCCACAAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCATTTTCCATGTTCTGATCCGTCGTCTCTATTTAGA
CTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTC
CCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGTGCG
TAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGT
CCTTAGGATTCGCCTCCGATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGGTT
CCACTTAGTACACGCCTCCAGTAGGGATGTTACTCTTTCGCACAACTGATTCCACGATTCCGCCGAGATTAGAATGTCGTCGATATAAGATCTGCGTCCT
AACACAGACAGAGTCCCAGGATCCCCCGGTTCTCCTGCTTCGAATGGATCTACTTCCGTGTGATCCTCTCCGGATCCACCCCTTTCGGGTTCCGGTATTC
GGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGG
TGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAACCCGCTGGCCATATCAAGAGAGCAGTACCAGAGTACTTTATCCAAA
TCTTCCAACAGCTCATGATTAGAGGCATCGGATACACCACCAATCGAGTCAGACTGTTAATCAGCCGGTAATCAATGCACAGACGTATATCCACCCGGTT
CTT