Description :
From Genome Similarity Track
Location :
Scaffold_4796:213- 1761
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_4796-abinit-gene-0.1Polyprotein

Sequence
1548 bases(100 bases per row)
TCAATGAAGATCACGAGCCCGCTTCGCGGTGTGAAGGCGATCACGCAGCTCGAGCAAATGTCGTGGGGCGACATGCTGCGTGATATCAAAGTTGGCGACA
TCGTGAGGCTGTGCGCAATCGTGACCGCGCCGCCAGTGCAAGAACAGGCGCTCGAGGCGAACGAGCAACCAGCTGGCGCGGTGTCGAAGTCGGCACGCGA
AGAGCGCTTCGCAGCGCAGTCATGGGAGGAGCTCGAATCTTCCAGCAACTCCGTCCTCGCGCTCGCGCGCGAGTTTGAAGACATCTTCCCGGACAAACTG
CCCGCGGAGCCGCCCGCAGACCGCGGGGTGCGGCACGAGATCGACCTCGTGCCCGGCACGAAGTACTGCGTGACTCAGCAGTAGCCGCTGCCGCGCGATC
AAGTCGAGGCGATCGACGCGTTCTTTGAAGGGTGTCGCGCGGCTGGGCACATGCGAGAGAGCATGTCGCCGCACTCCACTCCCACCTTCTGCGTGAAGAA
GGCAACAGGCGAGTGGCGTATCGTCCACGCCTTCAACAAGCTGAACGACGCGACGATCCCCGCGCAGACGCCGATCCCACGCAAGGACATGGTACTTGAT
GCCATGACGGGTAGTACGATCTTCAGTACCATCGACTTGACCGATGGTTTCTACCAGATCTTGATGCGCGAGAGTGACGTCTCGCTAACGGCAGTCAGTA
CTCCAAGCGGCATGCTCTGGGAGTGGCTTGTGATGCCCCAGGGGCTCAAAAACGCGCCAGCAACGTTCAACCGCATGGTCTCGCACGTGCTGCGCCCCCT
GCGCTAGTTCGATCCGAGTTACTTCGACGACATCTTCGTGCACAGCCGCGCCGATGAGGGCGCGGCGGATGTCGACATTCATCTTGGCCATCTGCGCGAG
GTGTTTGCGACGATGCGCGAGCACAAACTATATGTGAACTTGAAGAAGTGCATCTTCTGCGCTCTCGAGATCCCAGTCCTCGGCAGTTATGTCAGCGCGG
ACGCCCGCCGCGCTGATCCCGAGAAGACCTCATCAATCTGCTCGTGACCTGCACCACGAAATCAAAAAGACCTGCGGCAGTGGCTCGGCCTCGCGAACTA
CCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGCGAAAG
ACTTCGCGGTGACGATCTACCCGCTGTCGCAGCTGCTGAAGAAGGATGCCGCCTGGGAGTAGCGTCCAGAGCACCAGGCGGCGTTTGACAAGGTCAAGAT
GCGTCTCACCAGTGCGCCGGTGCTCGCCTTGGCGGACCACGCCAAGGACTTTCACGTCGTGTGCGACGCGAGCGACTTCGCGATCGGGTGCGCACTCATG
CAGCACGATGCTGATGGCTGCGAGCGAGTTGTAACCGGGCGTTCCCGA