Description :
From Genome Similarity Track
Location :
Scaffold_926:213- 1722
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_926-snap-gene-0.4Carbohydrate-binding protein

Sequence
1509 bases(100 bases per row)
GCCCCGGCCTTCGACGTGCCTTCGTTCGACTACACGACGCTGACGTCGGGCAATAACCCGAGCCTCGTGCTCGAGGCGCTCAAGAAGGACGGCATCATCA
GCCTGAGGAACATCCCAGCGTACGTGGCGGCCCGCGAGGCGTACCTGTCGGAGGCGGCGGCGTGCGCCGTGGCGGCGAAGGAGGCGAACGCCCAGTTCCT
GCTGCACAAGGCGCTCGCCGGCGGCGTGAAGCGGTACACGATCAGCACGGCGTCCGGCCAGGACCTGGATACGAGCGCGCTCGCGACCGAGATGGCGTGC
CCGGGCTATGCGACGATCTATCATGGCTTCACGAGTATCCTGGAGCGCGCCGTGGGGTCGCTTGCCGACACCCTGGACGCCACGGGGTTCACCACGCAGG
ACGGGTACGCGAATGTGGTGTCAACCCGCAAGCTCTTTGGCGAGGCGGTGCGTCTGGACCACTTCCACGCCTACGAGGCGCCGCAGCAGGCGACTCGCCA
ACTGAGTGGTGCTGTCCAGGAGCAAGATGACTTGTCCCTGCCGCTCCACGAGGACGACGGCATGTTCATCGTATTCCCGACACCGGCGTTCTACAAGGTG
AAGAGCGACAACAGCCTCGAGTCCGTGGCGGCCGGTGCAAGCGACGCCGACTCGGGCCTCGTGATCGAAACCCAGGACCACAAGCGCGTGCGTCCGGTAC
TCAAGGCGGACGAGGTGACCGTGATGGTCGGTACGGGCTTCAACAAGTGGGTCAAGACCTCGGACAAGCTGCCGGCGGTGACCCACGGCATGCAGATGCC
GTTGTCGGTGGAGCCGCTCGCGGCCACCGAGCGCCTGCTGCGCTCTTGGTTCGGCAAGATGACGCTGCTACCGTCCTACCACCGCATGCTCTCGCAGATG
ACGTTCGAGCAGCACGCGAACGCGACCACGCGTTTCCTGCAGCAGGACGCCGCGGTGGACATGATGACGATCGNNNNNNNNNNNNNNNNNNNNNNGCGCG
CCAGGCCGCAAGCTCGTGGCGTCCGCGACCCCAGAGTGCTCGTTCAAGGAGTGCAGCACCAAGGCTGGCGCCGCGGCGCCGAGCGAGGGCTGCACGGTGG
TCTGCAACCGCAACCACGGCGGCGACGCCGAAGCCTGTGCTGCGAGCTGCAGCTGCACTGTGAGCGCCCACCGCGCGACCAACTGCTGGATGTTGTGTGT
CAAGGATTTGGACACGTGCGCGACGAACGACCAGGTGTGCTCAGGCCAAGCCCTCGTGTGCAATGCGACCCCAGCGCCGACGACCAAGGCACCGACTCCT
CCACCAACGACGCAGGCTCCGATTACTCCACCACCTACGACCCAGACCCCAACCACTCGAGCTCCAGCTCCGAGCACCCAGACCCCAGTCACACCGGCTC
CAGTGACCCCAGGTACCCCAACTCCTACCACTCAGTCCCCAGGTACCCCAGTCCCAACCACCTCGACTCCTACCACCCAGGCGCCAGCCACCCTAACGCC
AACGACCCC