Description :
From Genome Similarity Track
Location :
Scaffold_44:212940- 214904
Sequence
1964 bases(100 bases per row)
GAACACATAGTCAGTTAGAGGGGTTCATTTAGGGAGGTGTCACTGTATATCCTATTCATTCGCTGCGACTACAAGTCAAAACATAGTTTACTTAAAAGGG
GAAGCGCAGAGCTTTCCAACAAAACAAAGCTCACATCATTCTGATTATTTGATGCTGAGATACGCTCCGTCAAAGTTTGGTGGTGCATTTCATCTCGCCA
CTGTAATCCGATAACACGGATTGCGTGAGGTACAGGGTAGATAGGCTGATCAGATTGACTTTTACACTTCAGTACAGTAGCGAAATACCACGCACAACTT
CAGTATGAATCCCTGAACTATCGAGCGGTTGACCCGACTGCATGTATTCTCATGCGCCAATCAGTCCGCTGCGTCAAAACTGACAGCAAGAATTACATAT
GTGATCTCCAGTGTGACAACGATCAAGTTCAAGCCCCACGCACAAAATGCATAAACAAATTGTGTTATACTTCTTCGTCGTGATACATGTACATGTATCC
CATAACGTCACCGCCACCGCGTTCTTTTTCAAGCAAGCCGTGCTGTTTTCTCACCATGACACAATGTGAGCTGCCTTCATCGTCCATCATAAAGCATGAA
GCTGTATCTGCAACGGGTACATTGCATGTAGTATTGAACACTAATCGAGACTAGTGGAACGTTCGTTCGTTCTCGCCACATGTGTTTCGATATCCTTGGT
ACGGATAACGACCAGAGGGGCTTTGCTACAAAGGATTGTCAGAGGCAATTTGGCTCAGAAGATTAAACTCGAAAGTGGAGACAAATTCAGTGTCCACTGA
TCTACACGTCGCGGATTCCTTTAAAAAAAATTCAAGTACGATGTTGTGGGTTTAGAACAGGGACATTTGCCGAACTGATGTTGGATACAAATACACTGAA
CTGGTGTATGTTTGACTGCAAGCGCTGGAGTAACTCAATCACAATGATCAGGTGTTGTATGCACGTCTACTTCCGGCCATTTTGAATATTTGCATTTGAT
TAACACGTAGTATTATTGTATTATACACAGGTTTTTTTTCAAGAATCGCCGCTACTGTACTTTCCGGTTATAGCGTGCCAAACAAGTTAACTATTTATAT
TACGCTTGAAAGCCTCCCTCATTGAGTCTCTGCAGATCACTGTGAACTTCGTTCGAGGCTTTTAGCGTTGGGCTACATGTTTCTCGCTGACGCAGCTCCA
AGAGCTCTTCTGTGCCCACTGTGGCCAGGCACCATTGGCTAGATAGCGCGTCGGTGCTCTCAAAATTTGAGCCCCTACACTATCGCTATCCGCTTCAGTA
GTGATTCGGAAGCTTTGTAGTGCTTGCTACCGTACATTGAGAGATGTTGTAAGTCTTATGAGACTTTTATCCTGCCTGTGAGTTGGCATGTGAGTTCTCC
AGTTTTCGCCAGACTTTTCGGTCTTGAAGCGTTTGCAGAGCTTCAGAGGCACAATCTCACTCTTGATCGCAGATGGCGTACAATTCCCTTGTTTCCTGTT
AGAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACCGTAAAAGTTTTTACTGTTCTGAACTATGGAGCCCAAAG
GCTGGGATACTGGGCAAAACCGTCTCTAACAGTAAATTTTTTACTGTTCTGAACTATGGAGCCCAAAGGCTGGGATAGGTTTTTCGGCTCTCCCATTTAA
ATACGAACACAACGAGCCCCCCGCGAGCAGCGCTCGTTACGGATCCCCCTTATTGGGCAAAAAGTAGGAGGAGGCCCCCACCGCCGCGTGCCGCCCGCAG
ACGTCGCCAAGAAACCCGAGTGCTACTCCGCCGTCCCGTGCAGGAGAAGGCGGAGCAGCAGCAGCAGCGCCAGCGCGAGCACAAGGAGTACGAGCAGCCG
CCCGCAGTGCGAGGCCACCACCGAGAGCTACCTGCAGTAGGAGGAGGCCGCCTCCGCCGCGTGC