Description :
From Genome Similarity Track
Location :
scaffold_465:2129- 3941
Transcript NameFunction/comments
g8588.t1 pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16

Sequence
1812 bases(100 bases per row)
TTCGTCAACAACGGGAGTTCCTTCCTATCTTTCAGTGCCGAGAAGAACTGATGCAGGTGATCCGAGAGAATCAGATTGTCGTGATTGTGGGTGAAACGGG
CTCAGGCAAAACCACACAGCTCACGCAGTACTTGCACGAGGAAGGCTACTCCAAGTTTGGGATGATTGGCTGTACGCAACCACGTCGTGTGGCTGCCATG
TCGGTGGCCCAACGTGTCAGTGAGGAGATGGAAGTAACTCTCGGTGAGGAAGTGGGCTACGCGATTCGATTCGAAGACTTGACGTCGGACAAGACGATCA
TTAAGTACATGACGGAAGGCGTTTTACTACGCGAGTCGCTGCGTGAGTCTGACCTGGACACCTACTCGTGCGTGATCATGGACGAAGCCCACGAACGGGC
CCTCAATACTGACGTGCTCTTCGGCATCTTACGCAAGGTGGTTCAGCGTCGTAGCGACTTCAAACTGGTCGTGACGTCGGCTACGTTAGACGCCGACAAG
TTCGCCAACTTCTTCGGTGGCGTGCCTATGTTCACCATTCCAGGACGAACGTTCCACGTGGATACACGTTACGCCAAATCTCCAAGCGACGATTACGTGG
ACGCGGCGGTGAAGCAGGTCATGCAGATCCATCTGTCGCATCCTCCAGGGGATGTACTGGTGTTCATGACGGGCCAAGAGGACATTGAAGCCACGTGCTA
CGTACTAGCGGACCGCATGGGAAAGCTGGACTGCGCGCCACCGCTCATGGTCCTTCCGATGTACTCTCAACTACCGGCTGATCTACAGGCGAAGATCTTT
GACGCCTCGGACATTCGAAAGTGCATCGTGTCGACTAACATTGCCGAGACGTCGCTTACAGTGGACGGTATCAAGTACGTTATCGACACGGGCTTCTGCA
AGGTCAAGGTGTACAACCCGAAGATCGGCATGGATGCTCTTCAGGTGAGCCCCATCAGCCAGCAGAACGCCAACCAACGTGCTGGTCGCGCTGGTCGTAC
AGGCCCTGGAGTAGCCTACCGGTTGTACACGCAGCGTCAATTCGTCAACGAGCTGCTCGAAGCGCAGATCCCTGAGATCCAACGGACGAACTTGGGCTAC
GTGGTGTTGCTGCTCAAGTCTCTTGGCGTTTCCAACTTGCTGGAGTTCGATTTCATGGACCCTCCGCCGCAGGATAACATCATCAACTCCATGTATCAAC
TGTGGGTCTTAGGAGCGCTGGACAACACTGGAGAGCTCACTGAAATCGGAAAAAAGATGGTCGTGTTCCCTCTGGACCCGCCTCTAGCCAAGATGCTGCT
CTTTAGTGAGCAATTAGGCTGCACAGCTGAGGTGCTGATCGTCGTGAGCATGCTGTCTGTTCCAAGTGTCTTCTTCCGTCCAAAAGATCGCGAGGAAGAG
AGTGATGCGGCCCGAGAGAAGTTCTTCGTGCCCGAAAGTGACCATCTGACGCTGCTGAACGTGTATCAGCAATGGGAGATGAACCGCCACTCTGCTCAAT
GGTGTTCAGATCATTTTATTCACGCCAAAGGCCTACGAAAGGCCCGGGAGGTGCGTGAACAGCTCGCAGACATCATGAAGCAGCAGAAGGTGCGATTTCG
CTCGTGTGAAGGTCGGTGGGACGTCGTTCGCAAGGCCATTTGCTCTGCGTATTTCTACAACTCGGCTCAAATCAAGGGCATCGGAGAGTACGTTAACATG
TTGACCGGTATGCCGTGTAACCTTCATCCAAGTGCCGCCTTGTTTGGTCTCGGTTACACTCCAGACTTCGTGGTTTACCATGAGCTCATTTACACGAGCA
AAGAATACATGC