Description :
From Genome Similarity Track
Location :
Scaffold_1396:2128- 7940
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1396-fgenesh-gene-0.1Erythrocyte binding protein
Pytiw_DAOMBR242034maker-piw_contig_1396-fgenesh-gene-0.3Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1396-fgenesh-gene-0.4Conserved gene of unknown function

Sequence
5812 bases(100 bases per row)
GAGCCAGGAGTGCCACATCTGCCTGGAAGAGCTCCGTCAAGACCTCGTCGCGTGCCCGTGCGGCCACGTCTTCCACCACGCGTGCATCCTGCAGGCGCTG
CAAGTGAACAACCAGTGCCCGATCTGCCGGCGTTTTGCGGCCGAGTCGCACCTCATCAATCTCTACTTCGACGTCCCGGGCGAAGCGCCGAGCCCCAACA
GCAGAGATCTCCACCATGGCGGCAGCTCGCATTACGCAGCACGAGACAACGGAGACGGCGAAGAGAGCAACGCGGCTGAGCTAGCGCATATTGAGAAGCT
GAACACGCGTGTGGGCGCGCTCGTGGAGAGGCTGCAGTGGCAGAAGAAGCAATACGACCTGCTCATCGCCGAGATGAAGCGCGTGCGGCACCAGAGCGAG
CAGCTCGTGATGGACAAGCAGGCGCTCATGCAGCGCATCGCCGCGCTCGAGGCGAGCAAGAGCGTGCTCACGAACAAAGTGGCCAAGTACCAGATGGAGC
TCAGCCGCCAGGCCGAGGCCATGCGGCAGGCGAAAGTGAACCAGAGCATCATCAATTACCTCAACACGTGCGACGCCGAGGCGATGGAGGAGGAGATCCA
AAACCCACGCGAGCTCATCATGGCGCTCAAGAAAGCATGTATGTGGCGGCTATCTGAGAGAGCGACTTGGCTGGATGATACAACTTGCTGACCTTGCATT
CGACTGCTCGTGTCTTTTTTGTGATTGTGTGAACAGGTAAATTCCGACATGACCAGTACCAGAAAGTCGTAAAGGACAAGATGCGCCTGAAAGCCATGCT
CCAGAGCCATTCACAGCAGCCCAGCGACGGTAAAAGAAAAATGAAGAGCAGCTCGAGTGGCTTTGAAAGCAGCAGCAAGCGCCAGTACGCGACAGAGTTC
AGCAACGGACCGCCGCATTCACTGGAGCTCAAGAAACGCAAGACCGACCCGACGTCCAACCATTCCGGGAGCTCCATGTCAGCCGCACAAGTAAATCCGG
CGTCGTCGCCGTCGGCATCCGTGGTCTTCACTCCGCGGACCGAGTCTGCAGGTTTCCGCTCGAACGCATACTCGGACGTGTCGGTGCGGCCCGTGACAAC
CGCACGGCCGACATTTTCACGCAGCAGCTACAATCCGAACCAGTATGGCGCATACAATATGACGCCTGCGAACGAGCCGCCCGTGCAAAACTCAGGCCAC
GCGATCTGCCGGAGAGGCTACGACGAGACTGGCAAGCTCACGAATTTCTTCCTGCCGCAGAATTCCAAGCAAAGAGGCGGTGGAACGAGATCATCGTCCT
CTGCTGACAATAGTAACAGCCGAGGAGGTTCGCAGCAGAAGACGATATCGGGCATGCATCACTTGCTTCAGAGTGCACAATCCCATAGCGGCGACTCGAT
GCCGAACCAGCGACCTGAGTCAGCGGCATCGGACCAGAGAGGGTACGCGCTCACGAGCTGGCTGCGGAAAGACTCGTGAGCGATTCGCCTTGGGTGACCT
GGGCGTTCGCCTGCTGCATTTAACTTAAACTTGTGGATAGGTTTGTAGAATTTGCATGTGATAGAGAGAGAGAGATGGTTCGAAGAAATGTAGATCTTGC
CTTTTGGCTCAGCATATCTCGATTCATTTTGATTTTATCGTCGGATGGCAAAATGACCAGCTCAGGTTGGTACGCTCAGCTTGTGAATTTGCAAGCGCAG
CTTTCGCAGCACTCCCTCCAGACGGAGCTGCAAGACAACCAAGAGAACGAAGACGTGAGTTCTATTTCGCATGACACATAACAATAGTAAAATCGCACCT
GTTGCTCTTGAGCAAATTGCTGGAAGCGCGGATCCTCGACTGGGAAGTTCACATTCGGAATCAGAAGCTGACTGATGTCTTCAATCGAGAGGAATGCACT
TTCCTCAGGCACTTGTTCGTCGCTTGTTGCTTCCTTCGTGCCACTCTCCTGGTTCAGTTGACTCAAGCTCGCTCTTCTAATGACTGAACTGTTGCTGGAG
ATGGTCACCGCCGGTGGTAACTGCGAGAGGCGAGCGCAGATCTGGTAGAAAGTGGTCGCCAGGTTCTTCAGATTCAACGCCGTCGCTTTGTTCATGTGTG
CTGAGCCAATGCCAACCTGCCAGGGCTGGAGAAGAATGTGCGGGACCAGGATACGCACGAAGAGAAAGTTCGCGAGCACAACGTCGAACCTTGAGGACGC
TGGCTTGCTTCTTCCAGCGCTATCTGGGTCGGCTGGCAACCCCTGGTCACTGTCGACTGGCGGCTCGTCCAGGCTTCGTCGCGTTGCACCGAGCTCGTCA
AACTCGAGGGCTCCTCTCTCAGCTGAAAACAGTTTGTACTGGTACAACAGCAAATATTATCAGCTTCAATACCTCTCAGTTCATCAATAGATTCAAAACT
GAGCTCTAAACTCGAACGTACACTCTCTGGGAAATAGAGTCCATCGGAAGTGAGGCGCCTCCAAAAGTCAAGAATGCCGCTGGGGATGTCTTGCCTTTCG
ACTGCCTTGGCGATCGCGTCGACGATCCCTTTCACGCGTACTTTGAGTTTCACGAACTTGCCTTCGTCCATTCCAGTGGGTCCGTTGATGTTGGGTTTCT
GTGGACGAAGCGCAAAGAGAGCGCCAAACTTGGTCGCGAAGCCTTTCGAGGACGACTTTGTACTCAGATCGAGATCCAAGCCTGGATCCTGGAGGACAGA
CAGCAACGGATTGCGCACGACTTTCCCGAGCCAGATACGCGTGGCATCAAAGTACACGTTCAGCATCGATTCAAAGTCCTACAACAGAGTTAGACAATGT
CAGAACCACACGCATACGCTGGTGCCGCCCAAACAGCAATGATGTACACGGAGCGCTTTGTCCTTTTGCTCGAGCTTCTTGGTTCGAATGATGAAACGGA
GCTGAACTGTAAAGATCACAGCATACGCTGCTGAACGGAAGATCTGAGTCTGCGCCATGGGTTCGACGTCCTGATCGCTGAATGAAGAGATTTCCCCGCT
TTCTCTCTCCATATCGATTCGCCATCGCGGTTTCCTCATCCTCGTTGAATTCATCGAAGTGTTGATTAGCTTGGCGAGGCGCTTGCGACTCTCCGTTCTA
TCACGCTCGGCGATCTTGTTGGAGTTTGCTGCTGTGGCATTGCCAGCTGTGTTTGCTGATAAGGTAGAGGGCAGGACCATCGCATCGTCCAGGTCTCCAG
AATCCAGTTGTTGAAGCATCTACAGGCACCCAAGACGTTGGTTAAGAGCACATACATCGGCAACAAGAGCCTTTCAAAAGAGCAACCGGAATCGCACCAG
CTCATCCTCGTCTGTCCAGTCGATCTCTGGGAGATTCATGCCCCACTTGGTGATATCTTGTTGGTGCTTGCCAGGACTTGATTCAGGTTTGCGAGGAGTT
GAGTCTGGCTTGTGGGTGGTTGGCTTGACTTCCACGTCACTAAACTTGACAGAGGAACGGTCTGGCTGTGCTGGAGGCCGTGGCGAATGTTGATCTGGAC
TGGTGCCTTTCGTTACGATATTAACGCTACCAGCAAACATATGAGAGCTATCAGCAGCCAAGCTCGAGAAACAGTGATGTGACCGATACATCACACACCT
GGATTCTCGCTGAGCTAGTATCACCGCCTTCAGCTCTTCGTTTTGCTGGATCAGTTTGGCGAGCAGATCTTGCAGAGATGGCGATTCGGAGCTCGTTTGT
CTTACGTTTGATTCCAGAGTTCGCGACGTCGAGGGATTTGATTCCAGCTGCGCCATCGCGTTGACTGTACTTTCGCCAGCAGCAGCAGAGAAGGCTCCGT
TAGGCGAGAATGTTCGAGCGTGTAACTCCATCTTGACATGTTAGTAGTCAGCATTCATATGTGAACAATTAGGTTGTCAGGTAATGCAAGAGCAAGCAAT
GGATGCATGAAAACGGACCTCGTACTTGAAGACTTGACCCTCAAGCTGCTGTAGCTGCGACCTGCAAAGAATACACACAGGTACGATTAGGAAAGACTTT
GGACTGACCGATGTCTGATCTTCACGGAGAGTCCTTCGACGCGTACTTCACTTGGACGCGTCTCTCCTGACGAACTCTCTCAGTTTTCTGTCTTTGGAAC
CGGAGCAACTCGTCTTCCAACTGTTGTCGACGACGCTGAAGCACAAGCGCCGCTGGTGTGGCGTCATCGTATCCTCTCGTTGGGATACAGTACTGTGATT
TGTTCATACTAACGAGTCAGAAGTCCATCGTTTGGTGTTGAGCTCACCTGCTGAGCGACGCAGCATCACTAGCCACATCACCTCGATGCAAGTATTTATA
CGCGACGCATACCGTTTCAGCGTCCGCATCATTGAGCTGCGACGCAAACAGTCAGTCTTCCCACAAAGCATAACATATCACCTTGAACCCCTTCTGTGAC
AAGCAACAAGTCAGCTCTTTTCACACCGTTATTGACTTTGCTATCCAGTGCCTCAGCCCACAACCTCCACGACAACTTCTTCAATCGCCGCTTGCTGCTG
ACCAACGTCGTCCTCTTCTCCGCTGTCATCTTGGCTCGAGTTCGAACCTGCGTCCTTATCTCCAGCTTCGCCTTGTTCCACAGGATCTTCCTCCTCCGTG
TCATCTTCACTCGATCGCTGCGCCTCCTTCACTGTTTTCTGCAGCTCTAGCTGCAAACCTTCCAACGTGTTGAGGAGCTCGAGCGAGCGCTCCAGCACCA
AGTTCGACGACTGGAGGATCGATTTCGATGAGTTGAGCGTCATGTTCGCCAGCATAGAGGTGTCTTTGGACGACATGCTCGACACCTGCTTCTGGGATTG
ACGGACCTGGGATTAGCATGCAAAAATAGCGGTTAGCTTGGTACTTCAGACAGCAAAGTGCCAAGACGCAGCATTTAGTACCTGAGTCATGACGGCGCGG
ACTTTGGCTGATATGGTGTTGTACTTGCACGTCATCTGACCGCAGACCAGCGGTAGCGACTCCTGCACGTTTGTGATATCGACGACACCAGGCGTGTGGA
TCCCGTCGAAGGGTTTGATGTCCGAGGGTGGCACGTGTACGAACAGCTTTGCGCTGAAGCTGCATTGGCCCACTTGCTTGAAATCATAAAATTGCGATTT
GGCTTCCTTGTTCTTCGTAGGTACGATCTCCAGCTTGAAGCTTATGCGCTCGCTCGTCCCTTCGCACTCGTCGCCGTCGTCAAAGAGCATTTGCTTGTAT
CGCATCGTGATCGGATCCACCAGCCAGCCGCGGTAAATGCTGCACACGAAGCGCATTAGGGCCACTGGTTAGCAAGCAAACAGCACCAATGAGGATTATC
TGACTTATACAGCTTACGCACCCTAAAATCTTCCTCGTCTCGGGCTCGGCGTTCTCATTCCCCTCGCTCCCTTCAACGAGTTCTGGCCTCTTCACCACAT
ACGTGACGTTCTTCAGGTGGCACATGTCCAGCAGCGCTCTGCGTTGACACACAATCATCCAATCAGTAACGATTCCACACACAGAATGAGCACATGAAGC
CTTTAAGACAATACAAGACTCACGCTTCGGTTTTGATCGTCACCGGGTTCGCCTTCAGACAGTCAAGCGACTCGAGCGCACCGACGAATGGACCTAAGTA
ATCACCACATCCACCACTGGTGAGCGCCGAGTCCATACACACACGAATCATACGTGATGAGCACGTATGGACTGCGCCACGCACAACGCACCTTGGTAGA
AGACCATCGGCTCTCGGAGCGGCACGGGGCCGACTGGCGCCGCGTTCTCCTCGGGCGTCGAGCGCGGGACGATGCGGATGGTCACTTTCGGAGCGGCCGC
GCAGAATGCGCT