Description :
From Genome Similarity Track
Location :
Scaffold_1476:2128- 3640
Transcript NameFunction/comments
Phyag_g10738hypothetical protein

Sequence
1512 bases(100 bases per row)
GCGTATTTGTAGTCCCGCGCGTTCGTCTAGGCTTTCCTTCCTGAAGCCTATTCCAAAAGAAGTTTTCTTGTTCGGTGGTGACCTCGAGCAACAGCACATA
TGGCCACGACACAACCAGTATCGGATGCTTCAAAGCAGACCACGCTCCCCAGTTCAACAatcggagaagaaggtcgcGCAGGTGATCGAAGCTCTGGAAC
AGCGCTTCGCAAGGCTCTtagacgaagaagagggtGGTGTCTTTGCAACGAGCATCATGTCTGCATTGAAGGTTGCTCGACTAACACAAGCGAAAGGTGA
GGAGGAAAGCATTCAGCAAGCCGTCGACCATGCACGGAGTGCCGTGAAGGAATTGCTAGAGAGGAATGCTTGTTATCCGGATCCGGGTGGGCTGTATCCC
CGTCTTGAGGATGTACGGCAGGTGCTATTGGTCGTCGTGCGAGCTGTTCTTGAGACGGATGGCAAGCTGGGGGGTTCAGGACTGCGCGAACTTCTCGATC
TTATCAAGAAGATTCAAGACTCGTTTCCAGGGTCAACTGTTCGCTTTAAATGGTACGCGCATGGTTTTGTAGTGCATTGGATTTGATCGAGGATTCTAAC
ACGGGGAACTTTGTTCGTTTGTGCAGGTGTAATTGTCAGCTACGTAAATTTATCACGCTGAAGTATAAACGATCTGCGGACATTGCACTCGCTGATCAAA
AGAGGCTGTTGAAGGTGGTAGACGAAGCCCGGGGCTGGAAGAGCGTAAATCACTGCACTGCTGCTAGATATGGAGAGGTGATGGCTTTCGTGACAGAAAT
TCTTGAGGGGCCCTACGAAGAATGGGAGCCGCGAGACGATCCAAAGCTGGCAGAGCTCATTGGCATCATGACTATCCGGGTTGGCACTTTTAGAGATAGT
AATGCACAACGAGGGCGCCAAACCGAAGTTAACGGGTGGGTGTACAAGATGTCAGGAGCTTCTTTCACGCCGACACTAGACCTGAAATCGGTTCCACCTC
CTCACATCACGGGGGTATATGTGACGACAAACCCTGGGTTCTCCTCAACGAAAGATGTCGACGATGGTTTTAATCGGATTTCTCGAGCGAAGGCAAAGAA
GTCCTTTGGGTTTTCCACGGTGACGCTATGCACCTTCCTGGCCACCGCACTTCTCACGCAGAACCTAAAGCTGATCTCGATGGATCTGCTCAATCGTTTC
AATGAAAACCTTCAGGGTCTCAAGGGTATGGATGTGGAGGGAGAAAGCTGGGCCGTTCTCCAATCGTAccaagagctggagaagattcTCTACCTCATGC
GTTTGTTCATGCATCAGCATCCAGAGTACGAGGAGTCGTCTGTCAGGTACGTCTTCAATTCGATGGGGTTGCCAGCTTGTGTTCGTTTGTGCTAACGGAT
TGGTTGTGTGTGGTCTCTTGCGCAGTACCATCGACACAGTGCTCGCACTCTTCCCACCATCAAAGTGTCCGAAGTTCGTGTACCCTTCCAGCACCGCAGC
ACCAGAGCGCAG