Description :
From Genome Similarity Track
Location :
Scaffold_72:2128- 3577
Transcript NameFunction/comments
Physo_538373Eukaryotic/viral aspartic protease, active site

Sequence
1449 bases(100 bases per row)
GCAGTATTGCGCGCGGCGTCGGGTACTCGGGGCGCTCCACCATAGGCCCTGGGGGGGGGGGGGGGCTCCGGGGGTTCCGCCTCCGCGGATCCAGCGTCCG
TCGTGGCCTACAGCGCGAGGTTCTGCCACGCCATGTAGCGGCGGATCCGATGGTCACGTAACCTTGGATCCGCGGGACTCGATCTCCGGCCAGCCACATC
CCGACTTGGAGGCTCTGGCGCAACACCAGCTCCTTCTCTCCGATGTTCGTGATCTGAAGGTACCGCACCTTGCCTGGGCCCTTGATCACCGTTGGCACCC
ATCGATCCCCTCGCATAACCCACAGCTTGTCATGTTCCGATCCTCGCAGACGCATGGGCAGCTCCGCGGACTCTCCGATCCCAAGTTGCAAGTATCGATC
CAGCGTCACGGACTGCACCTTGTCACTGTAGAGTGGACAGCGTCTGCTGAGCTGGATCAGGACTTCATCGGGCAGGCAGAGAGTCCCGTCGGCCAGATCC
AGCCGGATCCCGGCCGGAACCATGTAATCCATACCGAGGATGGCCTCTTGTCCAGATAGGTCAGCCACCCAAATGTCGAAGAAATACACCAGGTATCCGC
CCAAGGTAATCTTGATCCGCGTTCTTCCTTCCGTTGTATACACGATGTCCCCGATCCCAACACACTCTTGGCTCTGACTCCTGTCGATGTAGCACCCAAC
CTTACGAGCAAAGGTGGTATCCACGATGGACACCTCGGCACCGGTATCTAGGAGTATGATCGCTTTCTCATTGTTGATCTTGCCGTGGATCTTGGCTTGA
CGGAACCATTTCCCTGGCGAATGTTGTTTCCAGTACCCTCAGGATTCTCCGGGTAGGAGATACGAGGACTCTGGATCCGTGGTCCGCCGGTTCGCAGCAA
CACGCCTGGATCTGGATCCAGCCGTGTCTTCACCTTCGGCAGGTTTAAACCACTGGTCTGGATCCTGCTGCTTCCAGTATCCCTGACGTGCCTCCGGATC
CAAATCCATTTCCACTGTCGTGTCGAATCTGGAGTAGTCATCAGCTTGTCGGAGACTTGAGACCACAGCAGCACGTTTCCCATGAAGGTCACATGTATTA
CAGCGTAGATCCTGTCGTTTGCTAACTGGATCTGTCGATGTCTTGTTCACAAATGCATAGATGCAATATCTAGAACGCTCGGCTCGTACCGGATTCCAAC
CCGGCAAGCGTCCTAGTTTAACATCTTCTCCGCCATCTCTGCCAGCATCCCCGCATGCTTGGCTGGATTAAACCACTGGCGGATCTGGTTGTAGAACTCT
TCCATCGGGCATCGGCCCACGTCATGAAGTTCACCACATTCACGGCACACGAAAAGGCAGTGGTCACCTGGATGGCCCTTCTTGCCGCACTTCTCACACG
TCAAGCGTTTCCAGCAGCCAAGATGCGAGTGCTGCTTGGATCCACAGTG