Description :
From Genome Similarity Track
Location :
contig_87:2128- 3491
Sequence
1363 bases(100 bases per row)
GCTGATAATCATCTCCCTGATCGGCTCGTTGAGAGTCATTCAATTCGCCGAGTTTTGGAGCTGTTGTGCCCGAGGGTATCGGATATTCTTCCTTCTCGCC
GTACTTTAGGCAAATGTGTTCTACAATACCATGCTAATCGGTGCAAGGATTTGGATAAAGAAGCGCTCAACTCTGTGGTGACAACAACAGAGGGCTGGAT
CAACCTACTTTCAGACGCGTGGATGAATATTTGTAAGGAACACTTGCTAGGCTGCCAGCTTTCGCTATTTGGAGTTTTACTCACATACGCGCTACTACCC
GCTGGAGATGAATATCATGGAGTAACAATTGCCAAGCAGCTCGAACAACTACTGGAGCAAGTTCAGCAAGTGCAGTGACGCGTTGGAGCAATCGTCATTG
ATAACGCAAGGCAATCTGCACGCACTCGTCGAATATTGACAATTCACTGGTCGCACATAGTTTTTCTTTTTTGTTTCGCCCACGATGTCAATAACTTTGT
CAAGGCTGTATTGCGACCTTCGTTTAAAGTTGTGACAGCCCGAGCGTCAACAGCAGTCAAAAATGTGAACATTTCGTCTAGTGAATGGCTATGGCGAGCA
CGCCAAATGAAGAAGAAATGCTACGAAAACAACCTTGGCACTACAAATCTGTGAATCGAGAGGGAACTCGATGCAAGGCTGTTTCCCATCTTTGTTGCGC
GTACAGTCAGTATTGCAAATGTTCTACCGCCGGTACAAGAGATACGAAGAATTTCCACTGCATTTACGAGCTTTTTGGTGATCTCCTGTTTTGGGATGAG
CTCAAGGAAGCGGAAGCCGTTATCATACCACTGGCTTACGCATCGTACAGGCTACAGAAAGACGAGAATACGGTTGGAGATGTCGTACTTTCATTTCGCG
ACATTCACAATGGATTTCAGCAACATATCACTTGTCGTGATACACTGGTGGGTTGTATCGAGTCTCGTTGGGCACAGTGCGAGCAACCGTTTTTCATGCT
GGGTTTGCGCTGCATCCTTTGTACGCCGAAATCGCGAGGAAAATGCCCCATACTTCCGTGTCTGGTATTGGTGTGCTGTGCAAGATTGCGGTTAACAACT
ACCGCCGGCTGTTCGCTACAGAGGGTATCGGCCAGATACGGCGTGATATGTTAGCTTGGATGAAAGGACACTTTACGCGAACGAAACCGAGTGAGTTCAT
TGGTGCTACCTGAGAATACTGGGAGAGTGTTGCAGCCGAACGACCACAGAGCTTCCTCCCGAAACTCGCCGTGAGAGTGCTCTCAATTGCTGTAAATACG
GCCACGTGTGAGCGATGTTTTAGTGACCTTGGATCAATCCACACACCAAAGCGCAATCAAATG