Description :
From Genome Similarity Track
Location :
scaffold_66:21279- 28332
Transcript NameFunction/comments
Pl_110623aspartyl protease family A01B, putative
Pl_110624hypothetical protein PHYSODRAFT_474645
Pl_110625hypothetical protein PHYSODRAFT_470600

Sequence
7053 bases(100 bases per row)
GCTTCGTTCCGAGCAACGCGACTTCCCTCCCTTCGCACACGGCCCCAACAATTGTGCTGAGCAAGTGAAAGCAGATTTACAGCTAGGAGGTGAGCTCCGT
GTCATCTGTGCAGATCAATTGGTGACTCCACAACACCGACGTTCGCCCACTTCAGGTGACGATGACTCTGCTAGTAACGAAGACGACATCTCAAACAGCA
ACAATCAGGGAGGAATTGCTGACAGTACACAGGTGGAGCTCAAAGCGGCCGCATTACTCGTACAACACCGACGTGCAGGTGACAACGATCTACGCAAACG
GCTGGTCAACATGAAAGCAGTACTACCGTCTACCAACGCTGGTACTTTTATGACATCTCGACGTGTCGTGTCTCCGAAGTGTCAGCAGCTATTAGATGAA
GTTCGTCACGACATTATGATCCAGAACAGCGCCAAGAAGAACCCTACTGCTGCAGGCTCACCTCACGGTGTTGGTTCGCCACGTTCTCGTTTCGGTATCC
CTCTAGTGGGGCTTGCAAGTCGAATGACCGACTCCACAGCCACGCTGCGAGCGTTCTCAGTGCAACCACACGTCAAGAATAATCTCGACGATGAATTACG
TTCACCACGGCAACGCCGTGGCACCAGCGCGTGGTCAACGCTACTTCGGCACGAAATGGGATTCACTGGCAGCAATTGACACATCGACGGGCTGTCCGAC
TCCCTTCCTGTCTGGTTGGTGATGGTACACAGTTGTCAAACAATATTGCGAGTCGATAAATTAATGTTGGATTTTCACACAATTCTTCGGTAGTACTTGT
AACGAAAGGCCATTACACGCCACCCCAATTCATCAACGCGTCACAAACGACCTCTAGCACTACCAACCACTCATGTCGCTACGTTTGTAGCTCACATCCG
CTTCCATATTGCTATTGGTGAACAACGATTTTAGTTCTCCTTTCAATTCATCAGGGAGAAAGAGGTGTAGCGTCTTCGATGCCTTTTTCAACGCCTGATA
GACCTCTCTCAGCTGTTGCGTCATTGTCACGCTTGTGGAGGTCACACTCGATTTGTGTCTTGTTGTCCTACCACGCCAAGTTAGTAATTGCCCACAGCGG
CTTGGTGAGCTCCTTTAACAGAAGCGGTTATCGATCATGGGTCACACATAATCTGTCGTCGTCGTCGGCAATACTCTGCGTTCACAGCTTTATGCTTCAA
ATTCTCGAGCGGAGTCCGCGCCTCGTCGAATGTCACGACGAACACTGACAGGATTTCATATTTCAACTGGTTGGTCTTCATCGTCCTCTGCTTCTTCGCT
CCCGACCACGTAATGCTTACATCACTTGGCATCTTTTTACAATGCCGCGATCGTCACAGCCATAGCCAAAAACCACCTTCCATTCCTTTCCTGCGTCAGA
ATTGTCAATTGCAAACGTGAACGCACTTAAAGAGCATCAGTGATCAAACCCACAGCGCAGCCGTTGTTCGGAACAAGCCAATCTTGCGAAGTGGCTGCTA
CTCTGGCGACGATCCTACGACATTGTGCGCAGACGTACAAGACCGTTGCATTAAGTTGCCGAGTACAAGAAAATGTTCTCCCCAACGCTTTCTGTCAGTC
GCTGCAAGATGCGACTCTTGCCAAAGTCCGGCTCTGCGCGATTGTGTGTGTATCCCATCTCGAATTCGGCAGTCGATAGCTGACCACTAAGCATTTGTTG
CGCATTGTCCGCGCCGCCAGTTTCTCTTCGCCGCCACCTCCGAGTCCGTCTTCTCCACTTGTTAAAGAATAATGGTTGTGGCTCTAAATGATGTAATTCA
CACATTATTATGTTCTCCACCCGATATCAGCCCAATATACTGTATTTTAGGCGTCTGGGATTTCTAACTTTGGGCTCGAGGACGTCGTTTCAGTCTATCT
ACCCTGGTAGAAACCTGTCACTCAGGAAAACTGCCACGTGCCGAGACGCTCTCCCATCCGATCGGCAGCTCTCTTCCTCCGTTAGTTGTGTTTGTCAGCT
CAAAAGGATTCCCACAACATCCGAGCACTCCTCGTAGCTCAGTATTTACGACAGGAAGAGCTTCGTGTTTAACTCAAAATGATGCGCGTGATCGCTGGCT
TCCCGGCGGTTCTGTTGGCCGTCTCTACGCTCTCGGCATTGGCAGACCAAGAGGTTGGCATGACTATGCAGCTGCACCGCCTTCCCAAGCATGACATTCA
CCCGGAGAGATATGCAAGACGTCTTAACAATGAAGAAGACGCGCCAGAACTCGTGCCACTGCACTTGGGACTCGGGTACGTGGTTTTGTGCTGACATAAG
CTTTGGTGCTGGATCTTATGAGGTTATGATAATGCAGAACGCACTATACGTGGGTGTATGCGGGTACTCCACCGCAGCGAGCGTCGGTGATTGCAGATAC
TGGTAGTGGACTGATGGCGTTCCCGTGTTCGGGCTGTGATGGCTGTGGCAAACACACAGACAATTATTTCCAAGCCGACAATTCGTCGACGTTGGTCCAT
GTGACGTGCTCTCAGAAATCGTTCTTCCAGTGCAAGGAATGCAGAGTGACGTCGGATACTTGCTCAATTTCGCAGACATACATGGAAGGAAGCAGTTGGA
AGGCTTCTGTGGTTGAGGATGTCGTGTACTTGGGGGGCGAGTCTAGCTTTGAGGACGAGAAAATGCGCAATCAATATGGAACTCACTTTCAGTTCGGCTG
CCAGAGCTCGGAGACAGGATTGTTTGTCACGCAGGTGGCGGACGGCATCATGGGACTATCCAACACTGAGAATCACATTGTGGCGAAGCTGCATCGTGAA
AACAAGATTCCTAGCAATTTGTTCTCGCTATGCTTTACCGAGAACGGTGGTACCATGTCCGTCGGCCAGCCGCACAAAACTGCTCATCGAGGCGAAATTT
CGTATGCGAAAGTGATCGCGGACCGCTCTGCTGGGTAAGCTAGCGTGTCTTGACGTGTAATGTCGATGTCACTAATTTGTATGTTTGATTGTATCTTCAG
CCATTTCTATAATGTGCACATGAAGGACATCCGCATCGGCGGTAAATCCATTAACGCTAAGGAGGAGGCATTTACACGCGGCCACTACATTGTGGACAGC
GGGACCACCGACTCGTATCTTCCGCGATTAATGAAAACCGAGTTTTTGCAGGCATTCAAGGCAGTCTCGGGCCGTGATTATCAAGTTGGCAACGCGTGCA
AAGGTTTCACGAACGAAGACCTGGCGTCATTACCGACGATCCAACTCGTAATGGAAGCCTACGGAGACGAAAATGCCGAAGTCATCCTGGATGTACCACC
CGAGCAGTATTTGATCAACACAAATGGCGCTTACTGTGGTGGCATTTACCTATCAGAGAACTCTGGCGGTGTCATTGGAGCAAACCTCATGATGAATCGT
GATGTGATCTTTGACAACGGCAACCAGCGAGTAGGATTTGTGGATGCCGACTGCGCCTACGAGGGAGCTGCAAATGCGACAACAGCTCCGTCAATTCACA
AGGGTGCCACAACTGGATCTGAAGTTCCAACGGCTACAAACCCTGCCGTACCGAGTGCTACATCGGCTGTCGCAAACACTGTTGCTCCAATTGCTGTTGC
AACTATAGCACCTACAGCAGCCACTGTTGTATCGACTCCAGAGCCCACATCAACTCCAGCTTCCACTCAGAGTGTTTCTTCTCCTGCGCAGACGACTATT
TCACCAACAACAGCGACAGCTACTTCAGAGCCTACTGCGATGCCTGCATTAAAATCTGTAGCAACAGTGCCAACAGCAACGAACACTTCAACCTTGGACG
CTGGTTCATCTACTGGCACATCTACTGACCAGAATATTCAACCGTTGTCGGATGAAACCACGACAACAACACAGCCATCTTCTTCTGCTGCTACTGGAGA
CTCAAACCTGAAGGAGAAATCGTCGGGTGCTCATCCGATGGTACTCACAATCGTGGGCGCTGTCTTAGTCGTTGGGTTTCTGCTGATGATGTTGATTTCG
GTAAGTCGGAGGAGACAAAAGGACGGCAAGGAACAGCTCTGGAGTCGCGTGAAGGGAGACGAGGAGGATGAGGACGACGATGACGAGGAAGACTTTGGTC
TCGTTCGTAATGACAAACCGAAGGCTGTAACAACAAAGCACCAGCGGCTTGATCAGGATGATGATGACGACGATAACAACAGCAGCAGTGATGAGGAGGA
CGAGGTCTTTGACCGACAATCTGTGCAAGAGTCAAAGGTGGACAACCGCACGTTGGACCGGCTTTAAGTAGCTCAGAACCTGAACGACAGTCCAGTAAAT
AAAGATACATGAAATGTATTGTTGTTAAAGTTTTTGTCCTGATATAAAGTATCCATTTATCAAGCCAGCGCCATTATCCGGAATCCGGACGGCTCGTCTA
CTGATTGGTTATAAATAGATCCTCACCAATAACAGCTCCCCAACTCGTAGATTGAACATGACGCTGGCACTGCCTCGATGCACGGAGCTCAGAGCTCGCT
GGCGAGCATCTCTCGCTGTTCTGGCGGTTGTAATATGTTGCCAAACGTCCGCTGTAGTATCCGAAAAGCAGAGTCTCCTGAAAATCCAGCTCCACAAGCA
GCAGTCGGTCTCCGATCTATCCTATCGACTGGCACACCAACAAGCTCGAACTCGCAGACGAGCGCAGGAGGAGGCAAGTACCGTGGATGGAGATTTTAAA
TTAGGGGCAGTAGCTCTAAGTGAATCTCCATTGGGCGTAGGTTACGGGTGCGTATGTGCTGTAATGTTTAGATTGTGGTGAATGGAGCTGATAGCGTACG
TTTTGCAGCACACACTATGCTGAAATTTACTTGGGAATTCCTGCACAACGCGCCTCAGTGATCGTGGATACGGGAAGCCACTTAACGGCGCTGCCATGCA
GCTCGTGCAATGGCTGCGGACAACACACAGATCCACTATTTGAAGTGTCCAAGTCCACAACAGCAAAATATCTAGCCTGTCATGACTTTGACTCATGCCG
TTCGTGCGAACAAGATCGTTGCTATATTTCTCAGGTGTGAATTTCCTACATGTACTGTATGAAGTGAACTATGTACTAATGTTGTCACTGTGTTATTGCG
ATCGAGCAGAGTTACATGGAAGGTAGTATGTGGGAGGCTGTCATGGTTGACGAATTGGTGTGGGTAGGAGGATTTTCCACACCAAGCGATGAAATGGATG
GAATTCTGAAGACTTTTGGATTTCGATTTCCTGTGGGTTGTCAGACCAAAGAGACTGGTCTCTTTATTACTCAAAAGGAGAATGGTATTATGGGTCTCGG
ACGTCACCGCTCAACGGTCATGGCGTATATGCTGAATGCGGGTCGCGTGACGCAGAATCTATTTACTCTGTGTTTCGCAGGTGATGGTGGTGAGCTTGTG
TTTGGAGGTGTGGACTATAGCCACCATACGAGCAACGTGGGCTATACTCCTTTGCTCAACGACAACTCGGCTTATTATCCAGTCCACGTGAAGGACATTA
GGATGAATGGTGTATCACTAGGTATTGACGCTAGCACGATCAATTCAGGTAGAGGTGTGATTGTTGATAGCGGTACGACTGACACATTTTTCGACGCCAA
AGGAAGTCGGAACTTTATGAAAGCGTTCCGGGATGCAGCTGGGGGACGGGAGTATAACGAGAAGCGCATGAAACTTACTGGCGATGAGCTCGCAAGTCTT
CCGATAATTTCTATTATTCTGTCTGGAATGAAAGGAGATGGCACTGATGATGTTCAATTGGATATACCTGCGTCAAAATACCTTACGCTTTCCGATGACG
GTAACTCGTACTATGGCAACTTTCATTTCTCGGAACGCAGTGGCGGAGGTAAGTTTCATGACTGCTTTTTGTGTTTCCGTCAGCCCCTAATTTTCTTGGT
TGTATCAGTCCTCGGCGCAAGTACTATGGTTGGTTTGGATGTCATCTTTGATACTGAGAACAAACGTGTGGGCTTCGCCGAGTCGGATTGCGGTGCGTTA
CGATTGCTTATTACTCGATGACAGCAATACAAAACAAGGCTGACATCTTATGACACAGGAAAAAGTTATACCAAAACTAATGTGACAGAACCAATCGCTT
CAAATACCTCCACCCAGCCACCGTCTCAAACTGTGGTACCGGTTGCGTCAGAACCACCATCGGAAACGACGGTGCCGGTTGCTTCAGATATCAATCAGTC
AACATCTGTACCAACGACATCGAGTGCTTCGGATACTACTGAACAACCTGTGTCCACAAACACTTCCACTGCGAGCTCAAGCAGCAACTCGTCTATGGGG
TCAAATACAACAGTAACCGGGTTGGCGGATGCAGCAGGCAGTGCTGATGCGATATCGCATCGATCAAGTCCCAAGTTTGGCGCCTTTATTGCCGAAGTTA
TCCTCATCTCGCTGGTGGGTGTGGCACTTGCCGTCATGGTGTGGACAAAGTGGCGCACACGCTCATGGTCCCGCATTCCAGACTCAACGGAGACATCACG
TGCACAAATGCAGATAATAGTGGACGATGACACACCACCGACGTCTCCCACGAGAAGTACACTGTCACCTCGCTCACGAGCAGCTAGAAAGGGTCCATCC
CCGAAGTTCACAATCGGCTCCAGTGGAGAAGAAGACGAGCTTCGTGAAGAAGAGGAAGGCGTGAGTAGTCCCACCTTAGGTCGTGCACAGGGACCGCGTA
CGAACTTCTAGGCAACATTTTAGGCTAAACTACCTTATCCAGCTACGGCATTGGCCGGTAATTTGAAGTTGATCTGACTACAACCCTCGCTTCAGTGACA
TACTACTTGCACACAGTTCGATGGAGGACGAGAGGCGTTTGAAGCAGCGTGCCTTCCTGGACGCAGCAGCTCATGGGGATCTGGCTGGAGTTGACACATG
GCTTCGTACTGGAGGTGATGTGAACGTGACGATGGGCGAGGGATGGACTGCGCTGCTCTACGCTGTGGCACACAGTCGCTTGGCCATTGTGCGACGACTT
TTGGAGGGGAACAACGTCGATTTAAACGCTACCACAATGTACAGCACTTTCTT