Description :
From Genome Similarity Track
Location :
Scaffold_245:21270- 26440
Transcript NameFunction/comments
Phyag_g3908hypothetical protein PHYSODRAFT_558912
Phyag_g3909hypothetical protein

Sequence
5170 bases(100 bases per row)
TAACTGCATACAAGCCCACGCAAACTTCACGGCGGAGGCATTATCCTCTTCATCCTACTACCTCGACGATCCTAGAACGACTCCTTGCGGAAGCCGCGGC
CGTTGTGGTCGCCGTAGATCTCGCGAATGAGACCGATAACGCGCTCCACCGCTGGTAACGAGAAGGTTGCTGCAGCCCACGAGTCTCGACGagcctcctg
cagcaacttgtccCACTTGTCGGATCCCAAGGCGTCGGCCACACCACGGAATTCTCGCTCGTACGCCTTGCCGTCCGAGTGAGAGATCCCGCGCTGAGAA
AGCCAGAAGAGGAACGCGTTAGGCACACACTCGGTTGCGTCACGCTGGTACCGGGCGAGATCGTGTGCGATGGAGCCCTCCCACTCCATGTACTCGCCAA
TGCGAGCAAGGAAGTCCAATCTCTCCGGTGTCACTAACTCCGAAGCCAGAGCCAGCGAGTCGATCAGTAGCAGCAATGTCGCTTGCCAACGCGTTGCCTG
CACCGCCACATACGCTAAGAACCTCTCCTCGCGCGTTTGGTCTCCGGCCGTCGTCGAATCAGTCTTGTCGTTGGAGACAGTGGCCAACTCGTAACTCCTC
ACGatatcatccagcagctcccactGCTCCTTCACGAGGCGAGTACGGAGCAGCTTGTGCGGCACCTCCTGTTCAATGTGGTAATGCAGCACCTGCCACA
GAGCAAGGAACAGTGGCAAACCCGTCGACAGAATCTCGTCACCTGGCTCCACACTCTCCACCATAAAGTCGTGGAAGAACTTGTCGTCTAACTCGTGCAT
TTCGCCATCGTTGGCATCGTTCGCAGATCCGCTACTTGCCTCCAGGAGCTTGCGCATGAATGTGCGCACCTTCTGTGGGCGCACTTCCATGAGCCGATAC
GCGAGGATGTTGATGAGGATAGagagcaactgcagcttgttTTGCAGCCCAATGTTCGAGCGCGACACCAGCAGGTCCTTTTCCGAACTCGAGGCGGAGA
TGACAATCGAGCGCATGGAGgccaggaacaggaacatCTTCTCGAGTTGGTTGTAGCCTTTATCGCCCAGCAACTGGCGTTGAAgcgtcgtctgcgtctt
gtcAACCTTGCTAGCAGTGTTTGGTGCCATGATAGCAATGTACTGCGGGTGCTTGTTAATGGCCTCGAACGCAATGTTCAGGCTGATTgtgctctccagc
tccgggATGGGAATCTCCACATAGAACATTGACGGCAGCGTCACTGAGACCGGAGAAGTAGGTGGCGAGTTGCTTTGGATCTCGGAGAAAACGGCATGCG
CGTGCAAGTATTCCTTCGCCGTCTCGACGTTGATAGACTTTCGCAGCAACATGTAGCTACACACCTCCGACACGAGCTCGCTAggcgcaccagcagcaac
agcaatgtTTCGCGCGTGGAGAGCCATGTGGCCCTTCTGAATACCGGTCACCGCGATAGCACGAATTGCTGCGAAGTTCTGTGCCAACCCAACACTCACG
ATGATGCCGCTCAAAGTACGAGccgttggctgctgcagaatcgtGTGAGTCGCGGTGTAACCAGGGTGGGTCATCAATGCACCGCCCTTCGATCCGACCG
CAATTGGCATCTCTAAGCTGCCGCGCAGCACGCGAGTTCCGGAGCCGTCACGGGACTGACCGATCTCGTAGTGCGAAAGCGATGCGTACTGCCCCGAGCG
GCTAGCGTAGCAATGCGCGGCCGCCTCAATGGCTCGCCAGTCTTGGCCGGTGgctacagcaacagcatccaCACCGTTCATGATTCCCTTGTTGTTGGTC
ACCGCGCGGTACGGGTCGATAGCAGCAAAGTTGTAAGCCTCGATAATGCGGTTAGCCACATCTTCGCCGTCCACTCCCTTCCAGCCGAGCTTATTCAGAG
GAATCTCGAACTCAGCACGAGCGCGGCGCTGCATGCAGAGGTTGGTGAGAATGCGTAGCCCCGCACGACTGCGCGTGATCTTCGAGACTTCTTCCGACAG
CCCCTCCGCAACCGTGTTGACGATGTTAGCGCCCATAGCTTCGCACACGTCCACATCGATATGCACGACCAAGAACTGCGTCTGGGCTGCAGAGGCGTtc
accaccagctcgtcgccgCACGGAGTGTACCAGGCACCACCAGCGGCCGTAGTGGCGGCAGTCCGAGCAGCCTGACTCACCACACGGCAGTAAATGTCCA
CGGCACCGCCGCCACGCTTTTTCATGTTGGGGCAGAGCGTCGTATTGGCAATTGAAAGCAGTCGCTCGCGGTTACAGTCGatggcagcaattgctgccgg
GATGTCCTCCGTCCCCACGAGCTGGATCTGGGACGTCATGATGTTGCCTGACGTCGCCGTGTGGaagccaccgccagcagcagccacgagctTTGCAGCA
CTagaagccgccgccaccactgaGGGTTCTTCCACGGCCATGGGCACCGACAAACTTTTGCCGTCAATGACGAAGTTGAGTCCAAGTCTGCGATCACAAA
CAACAGCCACGTCACACCCGTTAAAATCATCAAAATGCAATCCATGGGTAGACCAAATGCCACCTACTCACCCAAGCGGGACGCCCAGCACGCCGATACA
ATTCTCGATCATGAGGTTGGCCGTGCGCAGCGGCAGTTCGCCGAGCTTTGCCGCCGGGTCCGAAGGCGGCAGGATATCGGCGGTTGCCTCAGCGCCGCCC
GTCTGCTGCGccttcagcgtcttgaacCGCGGGTGCATGAGCGCCAACACGTCGAAGCGCTcacgcagcgtcttgttgtAGAATCCTGACCAGACCGAGG
GCTGGTGCTTGGTGTCGGCGCTGTCGGGGCCGCTCCagctgtcgctggcgtcgtggctgggctgcagcggctcgaACTGCTTGGTACTGCTGCCTTTGGG
AACCGCGTTCTGCTTTTGCAGCTGCGCAGCCAGCGCCGTCACCTGTGCCGCTttccgctgcagcgcgtcgtccagcggctgCGAGGCCTTGAGCGCCGCT
CGTAGCAGCCCCAGCGTCTGGTCCAGCGCcgcttccagctccagcatccgAGGGGTTGCGAGCGACACGAgcgcgtcgccaccgtccGAGAGCTGGTTGG
TCATGGTCCGTGGAGGGAGTCACAGGGCGGGAGGCTCGGGCATACGACGGTGGATTGCAAAGTGCCGTACGCCAGCTCGACCCCCTCGACACCCTCGGAA
CAGGCAAGGGGCTGGAGGTCTCCGATTGACGGCGCAAAAACACAGCGTTGGAACATAGATGCAACTACATATAGATGTACATTGGaaacttcagcttcgg
ctCGTTATCTATTACGGGCTAGACATCTGCTGGGGCTTCGACGTGGGGAACGCCGCTGCGAGacggcgacttggaggggtcagatcgaggaggaaggaga
cgagCGCGGCCAGGAAGCGTCGGGCAACGAGCCGAGGGGTTTAAGTTGTACGCACCCCGGAAGATTGTGTTCGAGCCGGGTTCAACCCGACGAGATGCGG
TATGGGCACGATCCGAGCAACGTCGTCACGCATGACATTCGCCGATGGCATTTCCAcagccgagctgctgctgctgctgttgctaccATTTGCTCGCCCT
TTTGCTGCGAGCGAATCGAATCAGCCAGCAACTCCATGAGCTTTGCCCAAGACGACGAGTATACATGTAGCTGGCCAATTCACTGCGGAGACCTTTGTGC
GAGGGAGCAACGATCGTGACGTGGCGGTCGACACGCGATCGCAAATCGGATGCTTGTCCCTCGTGTAGGAGTCTGAAGgtccatgttgaagtcgccAACG
ACGGGTGGTCCTGCTGCCCCCACTTGCGCCGGGGTAGTCTACAGTCTACTGGACAGACGCTCGACAGAGTGGCAAATAGCAGGAGGTCAGGCGTGACATG
CGTCGTGTTGGCGGAGGCAGCCGGATGCACGTGGCAGCTCGATCGACATTGCAGAGCAGACAACTCCAGGCTCGAGCTCTTGCTTGTGCACGAGTCCCGC
CTTGGATGGTGACACTTGCATCGACGGGGAGCAGCACTGTATCGTTGTCGTCAAGCGAAATGAGATAAATAAGATGCCAACGCGACGTGGTCACCAACGC
AAGACCTGCAGTTGGAGGCAATAACGCTCTAGCCTACAGTGCAGAGCTCCTGGCAATTGCTAGCGATGAATCATTTCATTGCGGCTCCGACATGTACTTT
ACAACCAACTTGTTGATCTTCTGACATCGTGTTGATCTATTTGACTACGGCTGGGTGGCATGCCAATCGATTCTGCACTCAGACGAGTCCCGCCTTCAAG
ATAAGATCATCTAGGCTCGCGGCTCACGCCATGGACTCTTCTTCCCAGTCGTCATATTCGTCATAGGACTCttctgctggacgtggtgacACGGCTACGG
TTAGTGGTTCCGCCTTGGTCTCTGACTCAGCTGGGGATTCTACTTCTACTTCTacttcttgatctgctcTCTTCTCGTGCTCTGATGGCtgtggcgacga
cggcgcgttTTCAACGGGCTGGTCGGCAGCACTCGAATCTTCTGACAGTGCAGGCAGTCCCAGTGAGTCATAGCTCGTCTCGATTGCTAGCTCATTGTTG
CTTTTCGCCTTGTCCGCTATCACACCAGCGACTGCTGATGTGCCGTCGAGCCCGTATCCACTCGAGTATTCCACTGcatcgcgcagcttcttctccaaca
aacgcgccagctcttcttccaaTTTGCTACTTGGTTTGTGCTCGTCATGCTGCTCTCTCCAGCACAGTGCCTTCCAATAGTGGGGCAGCTCTAGCGCGTT
ATCGCACGTCTGAAGTGGAGCATGAACACAAAGTAGCACCATCAATACAACCACCAACTCAACACGTTGTTAAAAGACTCGTACATGAGCTTGCGGGAGC
ATTTGGAGGCACTTTTCGTAGTCGCTCGGAGAGATTACCGTGAAGGGCATCTCGATTCGTAGGAACTGGTTTAAAGTAACACACAAGAGCACACAATATG
ACTCAGAAGTAATTCAGAGCATCGGCAGAGCAAATCTGCAAGCGTACCTCGGTGCCTACCAGGGGCAGCGTATCCACACCCGTCACAAATTTGATGAACC
TCCGCTTTAGTTGTGGGTCGAAGTTGTTTACTGTTTGCCAGAATGCAGTCATCAGAGGCACACAATTCGT