Description :
From Genome Similarity Track
Location :
Scaffold_2350:2127- 5159
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2350-snap-gene-0.5DEAD/DEAH box RNA helicase
Pytiw_DAOMBR242034maker-piw_contig_2350-snap-gene-0.3RING zinc finger protein
Pytiw_DAOMBR242034maker-piw_contig_2350-fgenesh-gene-0.2Aspartate carbamoyltransferase
Pytiw_DAOMBR242034maker-piw_contig_2350-fgenesh-gene-0.0Metalloprotease family M20D

Sequence
3032 bases(100 bases per row)
GACGCGATGGAGCTCGCTGTGCTGGGGACATCTGTCCAATCTGCCTGCAGGGACTGCTCGACTCGGTGATGATCCAGACGTGCTACCACGTGTACTGCTT
CGAGTGTCTCAGTACGTGGGTGCAGAGCCTCGCGCTCCATGGCGTCTGTCCGCCGACGTGTCCGCTCTGCAAGGCGCAGTTCGAGACGGTCTTCACCAAC
GTCGTGTCCGAGCACGAGTACGAACTGTTCCGCTTCCACGGCCAGCAGAGACGAGACGTGAGCGCGATCACTCACCAGCGCGAAGAGAGTGCGCAGCGAC
AACAACGGCTGCAGCGCAGGTCGCTCGTGTACCGACGCCGCATGCGTCTGGCGAAACTCAATGGTGTCTCTGTCTCTACATGTAGCACAGCAGACTCTGG
CGTCGAGCTACTGGTGCAATACCCAAAGCTCGTGAAAGTGCGGGGCGAGTATGACGCGTGGATGCAGCGCGAATTGGAGGCGTGTATCGGTGCGGACATC
GACCTCACAGTGCTCGTGTCGCTCATCCAGTGCTGCTTGGACAAGACCCACCGCAGCGATGTTGCGAAGGGCTACAGGGAGCTCGAAGCTGCACTGCAGC
CATTTTTGTACGAAGACGCAGCGGTGTTTGTACGCGAGCTGGCGTTCTTCCTCGGCTCACGACTCAATATGGACGCCTACGACGCAGTGCTCGAGTATTG
CTGCTCAAGCTGCGACGAGTGTACGACGGCGTTGTGCGCTGCTGGTGCTGGTCACAGCTCACTAACATCGTAGACTATAGGCATTTGTAAGTAACTTAAC
GATTGGAGAACGAGAGAAACTCGAGCAGTGACGTTTGTGTTTGCTGATTAAATGTGTGTATAGTTGCTGATGAATGAAGATGCACGAGGGTGTGGCGGCG
TCTCTTAAGCGCACCACTCGCTTACTTCTTGCCGAGCACGAGCGCGAGCAGCGCCATGCGCACGTACATGCCGTTCTCCATCTGGCGAAAGTACGCAGCG
CGCGGGTCCGCGTCCACCTCTTCGGCGATCTCGCCCACACGCGGCAGCGGGTGCATGATCACCATGCTCTTCTTGGCGCTCGCGATGCTCTCGAGCGTGA
TCACAAAGCTGTCCTTGACGGCGTTGTACTCCTCCTCGGACTCGAAGCGCTCCTAGCAATACAAAGAGCCACAAAGAAGGCGAGATAGTTGTTAGTTATT
AAGCTATACCGCCCTTTAAAACACAAGTAGCACTCCACCTTTTGCACGCGCGTGACGTAGAGCACGTCGCTCTCATTGATGACCGAGTCGAGGTCCGTGG
TCTCATGCTGCGTCACGCCGCGCGCCGCCAGCTCGTCGAAAATGTAGCGAGGCATCTTCAGGCTCTCTGTTTAGCAGCAATTGCGGCATCCATTTGTCAG
CATCCAGCACACAAAGCCGCAGAAATAAAGATCGCAGCTGGTAGTTAGTCACCTGGGGCGACGTAGTTGATCGTGATGTTGAAGAGCGCGAGCAGTCTCG
CGAGCGAGTGCACCGTGCGGCCGTTCTTGAGGTCGCCGACCATCGTGACCACTTTGCCCGAGAGCGCATCCAGGTCGCGTCCTAACTCGTTGTAGATCGT
GTAGAGGTCCAGTAGCGCCTGGGTCGGGTGTTCGCCGATGCCGTCCCCGGCATTCAGCACGGGCTTCTTGGTCGCAGCGGCAGCGACCGCAGCGCTGCCC
TTGACTGGGTGGCGCAGCACGATCACGTCTGAGTAGCACTCCATGCAGCGGATCGTGTCGGCGAGCGTCTCGCCCTTCTTGCTGCTGGATGAACTCTCGC
TCACTGGCACGACGAGGCCACCCAGACGGAGCATGGCCGCCTGGAACGAGCACGACGTGCGCGTCGACGGCTCAAAGAACACGTTCGCGAGCAGCTATGT
GCAAGTATTAGCAGCGATAGAACGTTAGCGCCACTAACGCGAGTGCGTGTGCGCACAGACAGCTCGTACCTTTCCCTTGAGCAGGTCGCACGCGCCCTGA
CTCTTGACGATCGCGCGCATCTCATCGGCGACCTGCAGCACGCGTCTGAGCAAACACACACACAAGAGCAGCAGGCTCAGCCAAACTCCCAAGCACCTGT
GAACACATCAACAGAGAGCTCACTTGGCGCTCTCGACGCCAAACTGCTCGATGGAGAGGATGTTCTCGCCAGCCCACGATCCCTTCGCGTCCAGAGTCAT
GGTGAGTGAGCGAGTGCTGTTGAAGGTGCTGAGCTCTTCGTTGGTGATGTGGAAGTGGCGAAATATGTGTGGGCGTCAGTTTTCGACACTTCAGCTTTCG
ACACAACTCTCTTTTATTTACCTATATCATACAAATACATAACTCAGCTCTAATCATTTATTTAAAAATCCTCTTAAACATAGTTACTCATTATAAAAGG
CTTTACTCTACAGTTTACATTCACTAAGATCCGAATTTTGAAACCTCTGGACCCGCTCGCTTCGAACTTTACCACTAAACAAGCATAACATATTCGCCCA
CAAGCTCAGCCGCGAGTGATGAGCGAGGACAGCGCCAAGAAGACCAAGCAGGGCGCCGGCAAGCGCCTGAACGACAAGCAGCGCGTGGAGATCATCCAGA
TCTCGGAGAACTCCAAGACCTCGAAGCGCCAGATCGCCGAGAAGTACGGCGTGAGCGAGGCCGCGATCCGCAAGCTGCTGCTCAAGAAGGACGAGTTCCT
CAAGCGGTACTACGACACGCCTGAGGAGATCCGCGACCAGCGCCTGCGCGGCAAAAACTACGGCGGCACGCACGAGAGCGACGCGCAGGCGCTCACGCTG
GGCACGGTCACGGCCGACGAGACCTACAGTAGCACGTCCACGCCGATCAGCGCACCGACCCCAGCGTACACGAGAAGTCTCTACCCGTCCGATGAGCCGT
GGAAGCACGGTCTACACTCGCTCGCGGGCAAGGTGACGCCGTTTTTGAAGAGCTTTGTGCAAGGCAGGCCCGTGCGCGATGCGAACACCGTCGCGGCGGC
GCTGGCGACCGCTGCAGCAGTCGGCGAGGGCC