Description :
From Genome Similarity Track
Location :
Scaffold_3275:2127- 3492
Sequence
1365 bases(100 bases per row)
GTGCTCATGACCGAGCGCGCCAAGCAGATCAGTGCGTTCGTGTGCCCCCTGGGCCACTTCCAATGGATTCGCATGCCATTCGGATTGAAAAACGCTCCTT
TGATCTACCAGAAGATGATTGACAACGCCCTTTGGGGTTATGTCCGACTCCCTCCGCACTTAGAAGCCGAGGTCGAGCCAGANNNNNNNNNNCCTAGAAG
TCGTCAGTGAGCCAGCAGCCGCCCAGTCTGAGCTAGAGAACGCCAGCAAGACCGTGTTCGAGCTAAACATTCCAGCTCCACGGTGTATGAGTCCAGTCCT
ACAGCGAAGCTCGTACATTGACGACATTGCCTATGGGGCGTCGACGCTAGACGAGCTCCTCGATGTGCTAGACAAACTCCTGTATCGGCTCAGGTACTGG
CGAATATCCGTCAGCCTCCCCAAGAGCGCGTTTGGTAAGAAGTCGTTCCAGTATCTCTCGCATGAGGTCAACCAAGCCGGCATCATAGCCACGCCGAAGA
TCGCCAAGGCTCTCCGCGACATGCCGTTCCCCACGAGCTCGAGGGGTGTCCAGTCTTTTCTGGGTAGTCTGAACTATTACAATAAGTTCATTGAAGACTA
CTCAGTCATCGCGAGCTCCCTCTATGAGCTGACCGATGAGCGGATCCGAGCCAGCGACTCGCTCGATCAAGCCAAGCGCGCGTTCGAGCTGCTCAAGTCG
AAGATTCTGGCTCCGCCGTTGCTCAAGCACCCAGATCGCACTAAGCCGTACGTGATTATTCCCCACGCAAACCAGGAGCACGATGGTGTAATCGTGCCCG
TCCGGTTCACGGGGCGCACTCTGCACGATGCCGAGTTGAGCTACCACCCAGCCGAGAAAGAAATTCTAGCTTTGCTCCGCGTGTTGAATGTCTACTACAC
GCTGCTGGCTGGTCAAGACCTAGTCGTCTATACTAGGTTCTCGTCGCTCAAGTGGATCCTCACGTTGAAGTCTGTTCAAGGCCGACTCTTACAGTGGTCA
GCACTGCTGTCGCCGTGGACTATGGAAGTCCGGCGAGTCGACCGTGACGAAGATGGTCTGTCGGCTATCCTGGCTGCCAGCATCACGCCAAGGGAGAAGC
TCGATGAAGTCGCGGCTGGTCTCGTCCCGATGAAAGCCATGCGTGTCAAGCCGAACCTCGTCAGCCTGGAAATGCTCGATGCAGAGTACGTAGGCTATGT
GCTAAGCTTCGACGGTGCCGCCAAGCTAAAGACCAGCGCCAGCAGTGCCAGCTTCGTGCTCTGGGAACTGCCGGGCTGGCACCCAGTGTTCGCCAAGTCG
TTGTACATCGAAGGTATCACCGTCAATGAGGCCGAACACAGCGGACTACTGCAGGGTCTGGCTTT