Description :
From Genome Similarity Track
Location :
Scaffold_1123:2127- 3373
Sequence
1246 bases(100 bases per row)
CGTCCGCGGCCACGCCGCGACCGAGCATGAGGCAAGCGCCGAGGTCGAACTGCGCGGCNNNNNNNNNNGCCTCGGCGGCGATACGGAAGTGCCTGACCGC
CTGCTCGTCCCCCTTCTCCACGCCGCGCCCGTGCAGGTACGCGCTGCCCAGCTCGCGGTGCGCCTCGGGCATCCCCTGCTCGGCCGCCTGCGCGTACAGC
TCGACGGCTCGGCGCTCGTCCCGCTCCACGTGCAGGCCGCGAGCGTACAGGTGAGCCAGGTCGAAGCTGGCGGCCATGTGGCCGCGCGCCGACGCCAGCG
ANNNNNNNNNNCCGCCAGCGACCAGTACTCGAGCGCGGCCTCGGGGTTCTTTGGTTCATGTTCGCTGCCCTGGAACAGCAGCTTGCCCATCTCGTGGCAG
CTCGTGTCGTGGCCGGCGTCCGCCGCCTGCTGCAGGAACCGNNNNNNNNNNCGCCAGCTCTTCGTTCCGCTCGACGTCCGCGTGGCCGCGTAGGTACAGG
TTGCCCAGCGCGCTTTTCGCGCGCACGTGGCCCTGCAGGGCCGCGTTCGTCCAGTGTAGCACCGCGCGCTGCGCGGGCGACGCGCCGGGCTGGTCCGCGT
CCTTGGCCAGCAGACAGCGCACGCCAAGCGCGAACTCGGCGTCGGCGGCCGAGGCGGAGACGTCCGACGACGAGAGCGAGCGCAGACTCAGCGCGCGAAG
AGCCAGAGTCGGCGCACAGACCGTCGCTCGCAGCGGAGCGGCCGCGGTGCGCTGCAGACCGCGCATGCGGCCGAGCAGGAGCCGTCCAGCAGCGAAGGTA
GCCATGCTCGAGTGTTTTGTGGATGCTGCCTCTCCTCGGCGGAAAGAACCAATCGAACGGCGTTGGTTTGATTGAGATACGACGGAAACAATTTGGCAAG
AAAATGGTGCAATTCAATTATAAAATATGCAAATTGATTCCGCTGTTTTTTGCTGTTTTGCTGTTTTGTGCATTTTAGGTCCACAACGGTCAGAAATCGC
AAATTGCGGACAGCTTCCGGTGCGATTTGCCGCAATTCGACCATCCCGAACGCCACAATCGCGTGATGGGCCGGCCGCATGGTTCTGCTGCAGTGAGCCA
AGCGCCAGATGTTTGGCATCCAGCGAGCGATTTGCACGACGACGGACAGTGAAACGACGCCGATCACCTGAACCGCCACCAATGCGGGTATGCTCGCAAA
ATGCGTCGCAATGGATCCGATGCTTCGGCTCGTAGCTGCTGCTCAT