Description :
From Genome Similarity Track
Location :
Scaffold_66:212697- 215259
Transcript NameFunction/comments
Phyra_52114protein phosphatase PP2A regulatory subunit B

Sequence
2562 bases(100 bases per row)
TACTTTGTTGATGTACTTGTTCGTGGTACTTCCGTTGATACACTTTCACAATTGTTGACCAGCTCCAGAAACTAATCGCCTATTGCCAGCGCGAATGCTC
GGGAACTGAAAGAGGCCGCGCTTCAGTTGCTTCGTGTTCGTTGCTTTTGCTCGTTTGAATCCGCTGCTTGCTGCTGTACTCTCTTATCAACCGGAGATTT
GACTGTTGCCGCTAATTTTTGCTTGCTATTATATAATAGCTGAGCGACGCATCCAGTACTCTGCGCCAAAGCACCTAGGCGGCATATACGAAGAGGCTGT
TGCGAATAGATACAGCAACCTCGTTCAATGATGGGTGCCAGCTAGTCTGCAGGATCTTCTTCGAGAAATCCAAAGCATCAGGGTCGCCTGGAGCGGGCAT
TGCAGCAATCTGCTGCGCGAGGCCTCGCTGGGGCATGGAGTGCCGGCGGCTCACTCGAGCTGTGCGCGGGGTGATCGAAATATCGGCGCGTCCATAACGG
TCATAAATATGGAACTCGCTGTTATACGAGCCCGTGATGAAGTTGTTGCCATCCCCGCTGACCCCGCACTCGAATTTGTCGAAAATGCAATCACTCTCAT
AAAGATCCCCCAGTCGTGGACGAAGGTGCTCGTGGATCTAGACGTAGGAACAAACACGGTTAGTAAGACCAGCAACACCAGATCACCCTACCAGCTTTCA
ACGCCAATGCCGAAGCAGATATTGCACGACTTACATTGATCGTTTGAACCGGACGCGAGTTCATGTTGATGTCCCAGACTTTGAGAGTCAGGAAGTCGCG
TGCAATAATGTAGCGGCCGTCAGGAGAAAACTTGATGTCAGAGATCGACGCGATGATCTCAGAGAAAAAACTTCTGGCTTCAGGATCCTCCTGCTCTTCG
AAAACTGTAGCCCCGTAAGAAGTGTTCCTTATTAGGCACGCTTCACCAGGCCAACAACACAAAAAGTGCATCAGGAACAGTGCGCACCTTGAGAGTACGC
ATCACACAACGCCGCCTGCCGCATATCGCCCAGCTTAATGGCGCCGCGACTCGTGCTATACATCATCGTGTTGCAGTGCGTCGGGTGGAAATCCGCAGCT
GTGATAACCTCCGTGAGCTCTTCCATATTTGCTGGCTTGATGTCCACGATGTCTAACAAAACAACACCACCAACGCACATAAGTTAGAAATGGCATTAGG
CGACAACAAAAGCGAGCATCGACGAACTGAAGCTTTGATTCGAGATGCCCAAGCTCCACAGATTCACACGAAGGTCATCCGCCGACATGAACGTCTCTCC
ATCGCTGTTGATCGCGATCGAGTTGATGTGATACGTATGTGCGTTCGCGTAGACGCGTTTGGCTGTGGACGTCGTCACCTGGCCGCGAACATTGGTCTGT
GGTAGGCGAATGAGCTCTGGTGTGATTTGGGCCCGTGGCACGTGAGCGAGTCCCTGTTCGTTGTACGTGGTGACTTCACGCACGCTTCGCTCGTGTACCT
TCCAGAGTTTGATAGTCTTGTCGTTTGTAGACAGGAGGCACTGGGACCCGTTGGACGGTCGGCACCATTTGATCTGGTTGATCTTTTCCTCGATCTCCAG
ACTTTTGAGGTAGTCGAATTCGGCATTATGGCTCTGGAACTCGGCGTACAGCTGATACTGCGGGTCGTTCATCCCGCTGTACATGGTTTGATTCTGATTT
GGACAACATACAATGTCAGAGGATAAGACCTGCAGGTAAACTCCATAAGAGCACGGACCGACGCAAGGTTTCCATGACGACAGTAAATGGAGACTCGGCC
GCCCTTGTTCCCTGTGGCTAGAAAGTCTCCCGATCGGTCGTACTCAATCGCGGAAATCACCTCGGCTGCAGAGTCATCATCTGCAGTCAATAACCCAGCA
CCCTGAAAGCTGTAACGCCACCGAATCCCTACCTTCAACGAAGCTCCGGGCGCTTTCGCCCGCGGAAAAGACCTGACCCCACTCGGCTTCAGCTTCGCCT
GTGGGTTCTGCCATGTTGACTTCCAAAGCGCCGGCGTTAGTGTGCTTGAGCCTGGTCAGCGCACCCACTCGGCCCTCTTCGCCTCCGATGTCTCCGTGGA
GATTGGTTTGCGTCATGCAGACGCGAGGGGGTTGGGAGCTGCTCTCGACACGACCGTCTGCTTGGCGCTGTAAGAAGCGAAGCTGGCCAACGGACTGCTG
CACCTGCTGCTTTCGCCTTGGGGGTCCTTCTCTTCTTTCGCCGGAGGATCTCGAGGTGTTGCCTCAAAGGCCGCTTTGCTCCTCGGCTGGGGGTTTCGTT
TTTCACGCTAGCAGAAGGGCGGGCGCGACCACTTGGAGAATGGACGGACGAACGCAAGGCGAGGTCAGCACTCGAGGGCTGAAGCGACGACGGCGTCTGA
AGGATCTGCGGTGATGCAAATCCCGTTGTTGCCTGCTGGATGGAGTTGTCACGAGGCGACGAGCTCGAACGATGCGAATGGGGTCCCTCTCAACCGACCA
GACGCTGACAGGCATCGCGATCTTCAATCGCATTTTTTTTTCCATTTTTTGCTATGTACTGC