Description :
From Genome Similarity Track
Location :
Scaffold_354:21266- 22322
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_354-fgenesh-gene-0.5Isoform 4 of Protein CLEC16A

Sequence
1056 bases(100 bases per row)
CACGCTCGCTAGCATGCGCCACCTGCACGCGCAGCTGCTCAAGTTCGCGGAGCTGGGCGACGCTGAGATCGTGGAGCTGCTGCGCGTGCTCTCCGAGTTC
CTTATCTACTCAGACCAGAACCACGGGCCCGACGACGACGGCAGCGGCGGTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCTCG
AAGCGCTCGAGTTCGAGCGCACAACGTCGAGCGCGGGCGTGTTCTTTGACTATTTCTGCGAGAAGAACATCTTGGGGCTGTTCGTGCAGCTGGGCGCATC
GAAGCCGAGTGTGGCCGTGCAGATCCAGCTGCTACAAACCATGAGCATCCTCGTACAGAACATCGCGACACGCACGTCGCTCTACTACATCCTGTCGAAC
AACTACGTCAACAAGCTGCTCGAGTGCCCGTTCGCGGTCATGAAGGAGGATGACGTGCGCGACTGGTACGTGACGCTGCTCAAGGCGCTGTCGCTGCGCC
TGAACGAGGAGACGGTGCAGTTCTTCTTCGATGACTCGAGCGCGAACGCGTTCCCGCTCTACTCGCAGGCGCTCAAGTTCAAGCGCTGCTCTGAGACCAT
GGTCAAGGTCGCGGTCAAGACGCTCACGCTTAACGTGTACAAGGTACAGGATGACCGCGTGCGTCAGTTCATCCTCGCGTACCAGAAGATGGCGTACTTC
CGCGACATTGTCGAGTACGCGAACGAGCTCGCACTCAAGATCCAGGGCTTGCTGAATCTCTGGAGTCCCAGCATGGCTCAGACGCTCATCGAGAAGCTCG
AGGAGGCCATTGACGAGTACATTGATCACTGCTTCTACCTGCAGGACATCCTGGACGTGAACCTGCCGGAGCTGTGCTACAAGGTGGGTGACCTGATCTA
CAAACGCCATGTGCGCAAGTTCCTGGCCGCGAGCGTGCTACCGGACTGCAACCCGCCACCACAGCGAGTGTCCACGCGACTCGCGCTCTATTTGCTGACG
CGGCTCACGGGTATCTTTGAACACGCACCGCTCGTGAATGCGATCTCGTTCATGTA