Description :
From Genome Similarity Track
Location :
Scaffold_403:21265- 23300
Transcript NameFunction/comments
Phymu_g9533conserved hypothetical protein
Phymu_g9534actin-related protein 2/3 complex subunit, putative

Sequence
2035 bases(100 bases per row)
gcagaagaggagaaagacGCGAGTGCTGTGATCCGAAGTCTGTACGAGCCTTGGGATGACGTTAAACCGCTGGCGGTGGGGCCCATCGACCTGGTGACGA
GCTTCAATGGCGTTGGAGGATCCCGTGGGTACGTAGCGACGAGAGACCTGAAGCCAGGCACTCAAGTCCTGGTGGAACAGGTATATGTGCCTTGGCCAAG
TGACGTGGAGACATCGGACCCGGAATTCTTCCTAGCGACGATGGAGTCGGTACTGTCTCGACCCGACTACGCCGACATAATGGACCACCTTGGACACTTG
TTCCCTGAAAAGCTCAGCGAGCTGCCTGATGAGTTGCTGGCTGCAGGCAGGGAGAAGTACGGCCCCCAAGTGGACGAACTGTGCAAGAACTTCAGtgagc
tggtgctgtcgcACGatcaggtgctgcagaatGTGTTCGCCATGCAGTGCAACGCTTTCGACAGCGGTGTGTTCCTGTACAACGCGATGTTCAACCACGA
ATGCAATCCAAACTGCGTCAAGTTTACGCCGGAGGATGCTGGGCCGGAAGGCGGCGTGTCGGAGGTGCGAGTGGCACGACCGATTGCCAAGGGGGAGCAG
CTTACGATCTCGTATTTGTACCCGCGCGAGCAGAGCCAAGAGAACAGACAGAAGAATCTGTGGGAACAATTTGGCTTTGAGTGCAGCTGTGCGCTCTGCA
AGCGCGGTGACAGTGTGCTCCCTCCGCCTCCGAGTGCAACGAATGAGAGCGATGGAACGAAACCAGAAATGCCGGACTTGGAGAAGGTACTGGTTGGAGC
GGAAGAGATCATCAAGACGAACCCTGAAAGTGCTGCCGATGCGCTCTCTGTGGCGTTGGAGACGCTGTCTGACGCGCTGGAGATTGTGGCCCACGACCAC
TTGGTATGTATGCGCATCCACAAGCTGGTAGCGGACTCGTGTGATCTACTGCTGCGTGGGAAAACCGAGCGTGTCTGCGAGTACTCGATCCTGTTCTTGC
GCAGCAGttacgagctgctggagcttcagcgaATGTACCTGAACCCAGACCACATTGATCTCGCGCGTACGCTGAATGACGTTAGCCAAGGcatccagtt
gctgcttTCGTACGACCCgaaggtgctgctcacgGAATTTCCAGAGTGGAAAGACTTTCGCCAAGCCTCTGTAGTTGAGAACCAGTATCGACAGGAGTAT
AGACGGCTAAAGCGGATGTACGAATAGAATTGTGGCCCCGGTTGTAATTCGAAAGAGCATACTGCCTTGACCGACTGCTAGAAATGCCTGTCTGTGGTAC
AAGGAATGTCTTGCTAGTGCATCAACAAGGCGCTTGCTTTGCTGCACTTGAGTCTACAGGTACAATTGTAAAGATTTTTTACCTTGCCGTTGCCAAAGTA
CCAGGTAGGGTAAGAGGCAGGTCCTTTTACAGATGAAGCTTGCTCAATTCCACGTTCAAACTTCCCAGCTTCCATAGGGCAACACGGCCATCAAGTGCTA
AAAGTGAAAGCAGCCAAACAGAATTAGCGCATTCAGCATAACGTCATAAAGTCAGTCAGATTTCATTCTAGCGTACCCGACGTGGAGAATTCCGTGACGC
CTCCAGAGGCAGACTTCACGTAGGGCTGGATGCATGTGATGTTACTCTCGTGCTTCCTGCAATGAAAGCAATTTAGTCCCCAAAACGCAACAATACCTGC
ACATCACAAACCTAACGTACATCCACAGCATATTCTTGTCGTGCTGAGTAGCATCAGAAGACTGTCCACGCGTCACCTTGCTTTCAAAAAGACTACGAGC
TGTCATTCATCAGGAGCACGAATAATGATCAGTTAATACCCAACTCTCAAACACCCCGTGCATCAAGATCGTACCAGCATTGAAGCCACcagcgttcttc
ttcacagcgCTCTCAGTCGGTTTCTTGTCAACAAACTCAGAGAAAGACCTAAGCGAATAAACTCAGTTAATCTACTTCCAGAATACGAGCATTCACAATC
AAAACATTCTTACCAGAAGTTGTTGCCATCCTGGG