Description :
From Genome Similarity Track
Location :
Scaffold_51:212649- 217199
Transcript NameFunction/comments
Phyin_T30-4PITG_16651Putative uncharacterized protein
Phyin_T30-4PITG_16652Putative uncharacterized protein

Sequence
4550 bases(100 bases per row)
GGTTAAATCACGAGCGGTCGGCGTCATCCTCGAAGAACAATAGTGGCCAGGTGTCTATCAGCTCCGCCACAAGCGCCATCTCTGGTGCTGTAACAGTAAG
CTCTGGTGTCAGCAGCTCTGGGATATCTGGTCCGGTGAGGGTACAAGCACTAGTGGCGTCCATCATTACGGCTGGATCCATCGTAACGAAAGGCGAGCAG
GTGCCCTCGGGTCAACTCTGGTCGGGTGTTCCCGCCTCGCTAACTTGGGGAGCCCCCCCCCCCCAGGGAGAGAGAAAACCCATTTTCTTGCCAATGTGGT
CGCGGCACAATAACCCCCAACTGGGGGAAACTTTATATCGCGCGAAATTCCCCTTAAAAAACCTCCAGAGAGAAAAGAGAGTGGAAATGGGAGGGCTTAA
AAAAAACCTGGCGGAAGGGGGGGGAGAATGGTTCGCCCCAAAAGGCGATGAGCGCGAAGACACTGGTCTCTACTTCCGTTACTAGACGGCAAGCATAGTT
TCGAGTGCAGAATGGCGAAGAGCGAACAAAAATAATGAAAATGGGCTTAAACGATAGATTGGCTCCGTGGCTTATCATTTATAGGTGGATACTCTCATGC
CTACGAGTTGTGAGAGCTCACTCTTCGTCACTCTGTTCTTGCACCGCAACTACATCAAAACATACCGGTAATAAACATCAGTGTACGCAAGCAAGCAAAA
ACTTGTACCGTTGTCGGGCTTACAGGAGAGCGCAATCAGCTTTAGGAAAAACTCCCGCACTACAGGCTCTTGAAGTGTTGCCGTTATCGCAAAGTCCTTT
GGGTTGGCCATGAGCTGCAGCACAACATCGCCACAAACGTGAATTGCACGGCTATTACAAAAACAGCGCTTGCACCAGCCGTACCTGCTGCATGCTGGCC
ATTAAAATCGGGTCCTGCAACGCCTGCACGTAGTATGAGCCTTAGTTCATGGCGATCATCAGTGACGGCCCAAAGTGAACGCTCGAAAGTAATATCAGCA
TCTCGGCATCTTCGTCACTGGCTCCAGCAGAGCTGTGAATCTCCAACACCTCTTTTTCATCAGATGCAGGCGGCTGAACTAAGTCTGTGATAGCTTCCAA
GGCGCTCGCTCTGTTCTTCTTCACGCTGCTTTGTAAGTTCAAGCACCTCCAGAAAACACTTCAAGGTATTGACGGAATCCTCCTCTTCTGCATGAAAAAG
TAGCAGCTCTGGATCCTCGTCATCTATCAACGCATCACGGTAAGCTACCCATCTTGCTTCATCCACAAGTCGCATCCACAACGCGCCATTTTCAAGTGAA
GCAGCAGCGAGTACTTGCTCATCCAGAGATCGCTGAGCTGATCATTTGTCGTGTGGCTAGGAGAGCTCGCACTATCACCTGTGTCTTTTTTCTTTGACTG
TAAGAAGTCAATTAACTTCTGATAAAACCCTCGCAGCTCGTGGTCACCCAATTGAGATTCGAGGACGTCTGGGCTCAAACTCATGTCTCGTAGCGCCAAC
ACTATCTTCTCGTTTTGCTGCAGCAACTCGCGCATCGTGTCGTCATGCAAAATAGCGTTTACTGCCTGTGCGTCGAGGCCACCATGCGTGCGAGACAATG
CGACTGGAGATTACTTGCTAGCTGATTACCGTTTTCTCTTCCTGGGCCTTCGACTTTTTCTTCAGCGCCAACTTCGAGCGAAGCTCGCCCTCGCGTCCAT
TATACTTCGTTAGCAGCTTCTTGACAGTGTTTTCCCTTGGGGGCCATACCAAGCCAGTACATCATTTGATTAACCCCGCCGTTCACACTTTTTTTAAACA
TACCGGCATCCCCACATGATCATAAGAAACAACGATTGTTTTTTTGTCGCGGCATCAGATTCTCGATCTTTGAGTAGCAACTCAAGTTTTTCCAGAAGGC
TAATTGACTTGAACTTTACCATCGATGAAGAAGAAACACTTTTCTCTGGATTCGGGTAGTCTTCGCTATATAGAAGCGCTGAGCCAATTCAACAAGTTGC
TGTCATCACAAGCCACGTTATCCAAAACGTAGATCTCCCTCAACAGACTACTGTCTCTCGCTAGAGCAGTGCTTTTCGAGATTTCAATTGCCGAGTATGA
TGACGGTGGATTCCTACAAATTTCCACTTGCCGAATTAGACGCTGTGCACGACACTGTGGTTCAACGAGATCCTTGAGCACGACGGAAGGTTGTTTCTTG
AAGTTGGGACAAATACAATGAAAGTAGAACGGCATGTTCTTGTCATCATGGCGTGATGGCATTAACGTGAGAGCGAAACTGCCCAACCTCCAGGTAGTCG
AGACTCTGCTGAACTAAACGTGCTACTGTTTGTGTTTAAAGGTCTACCCACTTGATTGCTTTCCGCAAGCATTCGACAGAAATGAGGATTAGTCGACGTC
TCGAACCCCACCAACAGGCTTGAGTACCGAGTTTTTCTTCACGAAATTAACGTTTCCACGTGTGTGCGGATGTAATTTGTTAGGCATGGCAGTAAATCGA
AGATTTCCCTTGTTTAAGACGCGAGGCGGTTCAGGTTATCGAGACGGATTGCGGTCGTAGATGTTGCGTACAAACAATCTGTCCCGTTTTTCCTCTTGCT
GCGCGTTCACGTTTTCGTTTTGGTGAAGAATAGTCAGCTCCTCAAGCGAAGCGAAAATTCCAAGAGGATGCTCATTAATAAAAAGAACGTCCTTGTCCTT
GTCACGGATAGACGAATACGGTCGGTTATTGTAGGCAGCTGTGACCACTTGTTCTTTCCTACCCAGTGAGTTATGCGAGAGGTCTTCAAAGCCAAATACG
TCGACAATCTTCAGCAGTGAAATGCCTGGTGGGATAATCGGGTTGGAGTCCACACGAAGCTCATTCCTATCAGTGCATGAACCTCTCATTTTTGTTACTT
TGTTCGTTGCGGTAACGATGTACTCGAGCGCGAGCTGGTATAACAAACGTGCGAGTGTGTCTCGAACATGCTTTACCTGACCCTGCTCCAGAGTCACCTC
GAATGCTTCACTCGTCGATTGCAAACTTACACTTCTTGTCGTCATCATTCGTTTCAATTTCTCCACTGATTCCAACTCTACAAGTTCCACCACTCTTTGA
GGTGCATTAGGCACCCCCGTACATGCAGAAGACATCAAAAGCTTTCTCGATGTCTCATGATAGTCAAGCTCAATATTTTTTAAGCCACAGAACAGCACTT
AGCACTTTAAAAATTGCCTTCTGCTCGTCTGGGGATACGTTCAGCTCATCTAGCCCACCAATAATCTGCTGCCATCTTTCCACATCCTTTTTCCACGTTT
CCGCTTCGCTCATAAGCTCTGCCAGCTTGTGGTCGCTGCGACCGAGATCAGTAAACGCGGAGCACTTTACACCATCGAGATGCAACTCCTTCGCTAGCAA
CCGCATAAAAGGAAAAGGCGTTGACACCGGCCACCATCGCGTACAGTACGTGAAAGTTCAATTCATTCTGGTCTCCAGCTTCACGACCTCTTTCACTCAT
GACGCTGGATTTTTCTAGTAAAAACGGCGATATGTGACAGCCACAAATCTGAAACTCCCCCCAAAGGCAATTTGCAGAGTTGTCACTTTTCCAAACCTTG
ACGAATTAAGGTTCATCGACGTGGTAGCATTTCCAAACGCTTCCAGAATAATATTGGATTCCAAAACTCTGCTCAGTTTCTTCGCCGCATGTGGATTCGT
ACGATACATTAACAATTGTTCTTCATCCTAAAGATGCTCCAACTTGTCGTAAAAGCCAAAGAAAAGGTTGTCCACGTGCACCTGGGGGAGACGCTTACTT
CGACTCACTGATGCCATTTCTTCCCAGCGTTCAGGATGCCAATCCAGCAGCACGATTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN