Description :
From Genome Similarity Track
Location :
Scaffold_92:21263- 23604
Transcript NameFunction/comments
g11281.t1hypothetical protein

Sequence
2341 bases(100 bases per row)
TACATATACCTCCTCCTTCTTTCTGAGTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCCGCCTCGTGCG
ATTGCATCACTCCAAAGCGATTCCGTCTAGTGCGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCATCGACCCAAGACGGTTC
GGTGTATCCCTTCCAGAAGACCTGGAATTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCG
TCATCACTCCGATCACCTTCCCAGCTGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATCCTCGTCCGTTGCTAGCGTCACGTCAGGACGAT
CAGAGAAAACCTTCACGGCCTTAAGCTTCGAAACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAAT
CATCTCGCGCACCCGGAACGGTCCGTGCCACATGTGTGCAAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGCGACCCGGCC
TCAATCTGGTGCGGCCTTATCCCGTCGTTGTGGCGATCGGCCCTCGCTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACT
GTTGCTGGATACGATATCTCCATCTGCGCGGCTCGCGATCGTGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCC
ATGGACAAGGTAGAACGGCGTCTTTCCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTC
ACATCGGCGACATACATCTTCAAAGCGCGAGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCTTGTGGTCGATAGGCCATGGTGGCTCGCTGTC
GTTGTCCCACTATACGGCTGAATGCGCGGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAAC
GCATTCCTCGTAGTTCTCCGCGATGGTCTGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACGAGGAGCTCC
GTGTTGCCCTTGAATGATTTTAGCAGAGATGGGATGTGGTCCATCGCGATGATTTGGAAGGGATAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAA
CCACGGAGCGCCCCTTCCCTGTCTCGCAATCCACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCCGCCAGTGGAAGTGCGTTTTGATCCG
TTGGTACGTCCTCCCGATTCCCTGGTGCCCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGTAACGTTGCAGGTACCACCAGACGCGCG
ATCGAATCTCGGTCCTCGTCTAACCGGGTGGTGTTCACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTT
TTGCATCCCTGGTAGTCAAGGCTGCTACGTCGCCCCGTAGGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTTGTACTAACCTCTCACT
CCTCATGCGTTGGACGATCTCTTCTTGCATAGCTGCCGGCACTTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGACACTTGAACGACGGGGTCGTCA
TTACTCGGGTGGAGCAACTCGCCCAGGCGGTTGATCGTGACGAGATCGACAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTCGCACTTGCC
AACCGATCGGCGCTCTGATTCCAATCGCGCTTCACATGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGATCCATCGCTTTCTGACGTAGTATCTGGA
GACCCGGTGCCTTGCAATCGATTTCACCACGCATCTGTCGGATGATCAGATTGGAATCTCCGCAGATCACAACTCGCCCCCTGTTCTGATCGGACAGTAG
CTTGAAGCCTAGCAGAAGTCCGCGATATTCGGCTTCGTTGACAGTCAGATCGTCGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCTTC
CAAACAATTGCACTATACGCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCATCCAGCTCTACCGTCGGCGGAA
CCATCGCGATCGTTCGTTTGGGCTCTTTCACCGGTGCAATC