Description :
From Genome Similarity Track
Location :
Scaffold_47:212543- 214104
Transcript NameFunction/comments
Phyra_95639phosphatidate cytidylyltransferase, putative

Sequence
1561 bases(100 bases per row)
GCCATCCTGTACGGCGGCCACATGTACGCGTGGGGGCTCGTGGTACTGCTGCAGACGCTGCTCTTCCGCGAGCTCGTGAACGTGCGCTACCGGGCGGCGG
CCGAAAAGAATATCCCGTGGTTCCGCTCCGTGCAGGTGCGTGCAGCTGCAAATGGAGAGGGGGAGGAGGAGGGAAGGTATAGACTAATGCTGACTCTTGT
GGCTGCAGTGGATGTGGTTCGTGGTGGCGCTGTTCTACAACTACGGCGACTCGTTCGGCGCCTTCATCGAGAGCAGCAAGATTCGCTTCGTGCCGCCTGC
CATCGTGCACTACCTGCGGTACCACACGTGGGTGTCGTTCACCATGTACGCTATGCTCTTCGTCATGTCGGTGCTGAGTCTCAAGAAAGGTGCGTGACTG
TAGATTTGATGTTGAGCTCGTTGTGCTGTCGTACGGTTGCTTCAACGACTGACGCTGTGCCGACGAACATTTTGGTGTCAACGATGTGGTTTTATTGACT
GGGTAGGTTACTACAAGTACCAGATGGGTAAGTTGGCAGGAATCTCGTTTTGAGTTTGCAGACATTCTAACTTGTGAATTTCTCGCTTGCAGGGCAATAC
ACGTGGACCATTGTCACGCTGGGTTTGATCGTCTTCCAGATGAAATACGTCCTCACGAATATCTTCAACGGTACGAATGTAACAAATATCCCGACCTTGT
CACAAGTTGCTAACGGGATTCATATGCTTGTTCACCCCTCTAGGTCTCTTCTGGTTCTTGTTCCCCGTGTCGCTCGTGATCTGCAACGACTGCTTTGCGT
TCTTCTGCGGCAAGCTTTTTGGTCGCAAGTTCATTAAGACGCCGTTCCTGCGATTGTCCCCGAACAAGACGTGGGAGGGCTTCATAGGTGCTTTCGTTTG
CACCGTGATTTATGCCTTTTTTTCCAGTGCCTTCATCTCGCAGGTACGAAGCAAACACGGTACCGTTTCGCGTATTTTGTTTATTGATTGTGTTGTCTTT
TGTTCGTTTTAGTTTTCTTGGTTGACCTGCCCCGTGGAGAGCTTCGAGGTGAGAGCACAGTGTTTAGTGCTGCAAAGCACTGGTCTTCATGCAGCATACG
TGCTTATGGTAACACTGATGTCTTTATTTTGCTACAGTTCAAGCTGATTCCCGACCCACTCACGTGCACACCTCGTGACGTGTTCCTCCCTCATTCCTAC
GGCGTACCGGTCTACCTGGCGGGTCTAATTGGTCGAAGCCAGATCCAGCTTCTCCCGATTCAGGTTTGATGTTGTGGCTGGCTAGATCGATGTATGGCGA
TTGCTGACGAGCTGTCTGGTTGTGTTCGTGAATGCAGTTTCACTCCATCTGGTTCGCGATCTTCGCCTCCGTGGTGTCACCCTTCGGAGGTTTCTACGCT
TCGGCAATCAAGCGTACGTACAACCTGAAGGACTTCGACTCGGTCATTCCTGGCCACGGTGGTGTCATGGACCGAATGGACTGTCAGCTGATCACAAACT
GCTTCACGACGGTCTACTTCAACACCTTCATTCGGTATGTCGTTTCTCTAGTGTTCACACG