Description :
From Genome Similarity Track
Location :
Scaffold_26:212541- 214038
Transcript NameFunction/comments
Physo_133441reverse transcriptase

Sequence
1497 bases(100 bases per row)
CGTGAAGGAAGTGAGTTGCTCTCTCAGTTGCGTGACCAGTTGGTTATGCTTCCTGAGATGCGTGACTTGACCCCTGAGTGCAAGATCGAGGAGGCAGATG
TTGGAGTCCCTGGGAAAACGACGCCCGAGATGGAAGACCAAGTGAGGCGAATTCTGGAGTATCATCGGAAGATCTTCTTGGGAGACGGCAATGCAGCTCC
CCCACCTGCCCGTGGAGTGGTTTGTGACCTGGATGTAGGCGACGCTAAACCTGTTGCCCAGCGTCCAAGGTCCATTGCACCACACCTGTGGACTAAGGTG
TATGAACTTCTGAAGAAGCTTCTGGAGAACGGGCTGATCGAGACTTCTACGTCCCCCTGGGCATCTCCAATCGTGATCGTCCTCAAGAAGAATGGCGTCG
ACATCCGGATGTGCATCGACTATCGCGTGGTGAATGGCTTCATCAAGCTCTCACACTATCCGCTGCCGCTTATTGATGATCTTTTGATTGGCTTTGAGTC
GGCGATGTGGTTTATGAGCTTGGACATGGCGAGTGGTTTCTGGGCTATCAAGATGACCGAGAGAGCCAAGTTGATCTCTGCGTTCGTCTGTCCCTATGGG
CACTACCAGTGGGTCAGGATGCCGTTTGGCCTCAAGAACGCGCCGCTGATCTACCAGGCAGTTCTCAATAACTGTCTGTGGGGATTTCTGCGGCTTTCCC
CTGAGGAAGAAGCTGAGGTCGACCAAGATGTCTTGGACTTTTGGGGGTTGAACTCTGGGGAACCCAGAGTTTCAGGTGAAAATGCACCGCGACTTTCAGT
GTTGACGGATGAGATGACTGTTTTTCAGCGTAACATCCCGGCTCCCTCTCAGATGGGCCCTGTCCTGGGTCGAAGCTCGTATATCGACGACATCGCCCAC
GGTGCGCCTACTTGGGAGCAGCTGTGCCAGGATCTGAACGCGCTGCTCTTCCGATTACGTTACTGGAATATCTCTGTGAGTCTTCCCAAGAGCGAATTCG
GGAAGTTGTCCATTCCGTACCTCTCTCACGAGATTAGTGCTGAGGGCATCCGAGCGACCCCTAAAATCGCGAAGGGGGTCCAAGACTTGCCGTTCCCGAC
GACACTGAAAGGCGTCCAGAGTTTCATGGGGAGTCTGAATTACTACAACAAGTTCATTGAAGATCTACCCGTGATCGCGGCCGTCCTGTACGAGCTAACT
GAGGAACAAGTGAAATCCAGGAGAGACCTGTCGAGATCCCAGGAAGCCTTTGAAATCCTGAAGCGCAAGATCGTTTCGACTCCGTTGCTCAGACATCCAG
ATCGTTCAAGGCCCTTCATGATTATTCCCCACGTAAACCCGTGGGCAGCATCCGCTGTGTTGGGCCAGGAGTACGACGGGATTGTGCACCCGGTTCGATT
CACAGGTCGCGTCTTGAATGACGCTGAGCTGCGGTATCACATTGCGGAAAAGGAGGTGATTGCTATCCTGAGAGTCCTGGAGGTGTTTCGCACTTTG