Description :
From Genome Similarity Track
Location :
Scaffold_2467:2125- 3455
Sequence
1330 bases(100 bases per row)
TACAAAGAGCAGATTCAACAGCTCATCTCACACGCGCTGGACGAGTGCGATCGTGCCGACGAGATGGGTCGGGCAGCCTACAACGAGCCGTGGGTGATCG
TGGGCGTACAAGACAAGGTCACGGCTCTGTGGCGTCAAGAGCAACCCACCAATACACCTAGACACTCGTCATGCACGCACAAGTCGGAGTATCGATTGAT
CGGCAACGTCAGCGGCAACTACCGCGACCTCATGGCGCTGCACTACGCCGAGACCTCCAACGACCTGTACGAGTGGTTCCAGTTCGTGCACCAGTCGACG
CTCGACGCCCACATCATCCAGACAGTCGAGTCCGCGTCTGCTGAAAGACCGCACCAGTACTTTGGCGTCAAGTGGGCCGCGTTCCAAATGTCCAAGCTAG
CAAACAAGGCAGACCAGTGCTTTGTCGAGTACATGACGTATCGAAAGGACCGCCAGGGCCGCGAGGTTGGCGTGCGCGTGACACTGCCGATCGGCCTTCC
CGAGATCGACATCATGGCGGACTCGCTCAAGATGCGCCGCATGGATACGCAAACGGTCCAGATCCTGCGTCCGCAGAACGAGAAGACGACGCGTACGTTT
GTGATGATCAAGAACGATTTCCTGCCCGCCGCGCCGGCCACGTACATCAAGACGCTTCTCGCACAGAACGTGAACGCGGCCATGGGCATGGATGCCCGCC
GCATNNNNNNNNNNNNNNNNNNNNNNGGACTTGTGGCTCAAAAGGACTGGATGCCCAACGCCTCCCGTCGCGGCTGCGTCGTGTGTTTGCGCACGTTTGG
CGCGACGCGCGGACGCCACCACTGCCGACTGTGTGGCGATGTGATCTGCCGCAAGTGCACCGTCATGAGGGACACGGCCGAGCCGGTCACACGCAAGACG
TTCAAGGTCACCAAGACCAAGTTTTGCGTGCTCTGCATTGCGAACTTGCGCGGACGGGACGAGGGCGACCACACAATCGCTGATCTCTGGGCGGATCATC
GCCGTGAGACGGACTACATACCGAACAATTCGATGGACGATGGGTCCAAGTCTTCGGTGTGGTCCGAGACCGATTCCGAGTGCTACAACGGCATGGTCCT
CTTCCTGCCCGAGGACACAGTGGACTGCATTGAGACGATCGACACCAAGGACATGATCCGGGGTGCGAGTTTGGGGGGCGAAGGCGAGTCGCCGCTGAGC
ACCTCGGGCGTCTTCGAGTCGAGCAGCTTTGGTGACTTCAAGAAACGGCGGAGCCGCACGGACAGCACCAACCTGCTGAGAACGTCGGCGCGGTCTCTTG
ACCAGAACCTGGCCGAGCAGGAGGCACTGC