Description :
From Genome Similarity Track
Location :
Scaffold_2:21244- 22517
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2-snap-gene-0.44DEAD/DEAH box RNA helicase

Sequence
1273 bases(100 bases per row)
ACACCATGGGATTTACACACATGACGCCCGTGCAGGCAGCCACGCTGCCGCTCTTTCTCAGCAACAAGGACGTGTGTGTGGACGCATGCACGGGCAGTGG
CAAGACGCTCGCATTCGTGCTGCCGATCGTGCAGATCCTGAAGACGCGAATGGCCGACAGCACGCTGAAGGCGCCGCGCGATGACATCACGAAACTCGTG
TCGCTCATCATCTCACCGACAAGAGAACTCGCGCGTCAGATCTACGAGTGCGCGTGTACGTTTTTCGCCAAGGCGCTGCCAAAGGTGAAAGTGCTGCTCT
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTGGTACGAGCGTCGACGAGGATTTAAAGTTGATCCGCAGTGCAGCGGGTAAGTGCTCTGTTGT
GATTGGCACGCCCGGTCGAACCGAGGATCTGATGAACCGGTGCATTGGCTCGACCGTCGAGACCCGCGACTTCGAGATCCTGATTTTGGACGAAGCCGAC
ACGCTGCTCGACATGGGCTTCGAAGTGAGTATCAACAAGATCCTTGAGCATCTGCCCAAGCAGCGCCGTACGGGTTTGTTTTCCGCGACGCAGACGCAGG
AGGTGAAGGCGCTCGCACGCGCAGGACTTCGTAACCCGGCGACGATCTCCGTGCAGGTCGCCAACAACACGCAGATCACGCCATCGACGCTCAAGAACTT
CTACGCGCTGGTCAGCCACGAGCAGCGGTTGTCGGCACTGTGCCACTTCCTGCAGTCCAAGAAAGCACAGAAGATGATTGTGTTCTTTTCGACGTGCTCT
GCTGTCGATTTCTTCAGCCGTGTGCTCGAACACTTTTACGAAAAGGACGCCGACGAGTTTCCGATCGTCGCGCTGCACGGTAAGATGCCGCAAAAGAAGC
GCACGACCAACTATGACCGCTTCGTCGCGCTCAAATCGGGCATTCTCGTGTGTACCGATGTCGTGGCGCGCGGCATCGATCTTCCGGACGTCGACTGGAT
CATCCAGTATGATCCACCGCAGGACCCAAACTTCTTTGTTCATCGCGTTGGGCGAACGGCGCGTGCAGGACGCACGGGCTCGGCGATCTCGTTCCTGTCG
GCGAATGAAGACGCATACGTGAACTTTCTCAAGATCCGCAAGGTGCCGTGTGAAGAGATGAAGCTCCCGCTGGACGAGATTGAAGACATGCTCCCGAAGG
TCAAGGAGCTGATCCTGAGCGACCGCGATATCCTGGAGAAGGGCACAAAGGCGTACATCTCGTTTGTGCGGTC