Description :
From Genome Similarity Track
Location :
Scaffold_74:212432- 215970
Transcript NameFunction/comments
Phyin_T30-4PITG_18999Serine protease family S08A%2C putative

Sequence
3538 bases(100 bases per row)
AAACAGGAGTCGACGTGTGCGGGGACGAGTGGCTGTAAGGTGTCGCTGGAGACGCCCGGTGAGGTGGCGAACCTCATGAAGGCGCAGGTGGCTACAGGCG
CCAAGATCTTCTCCTTCTCGTGGGGCACAGGCGCCAACGACTACAACACGCAGACGCAGCAGGTGGACGAGTACATTTACGACAATCCGGAGATCCTGAT
CATTGTGGCGGCAGGAAACAGCGGCGAGAGTGGCGACTACACCATCAGCAGTCCGTCGGGCGCCAAGAACGTCATCTCGGTGGGTGCGAGTCTCAATGCA
GCCGCGTCGTTCTCGTCCACGCCCTGCCAGTCGGTTCTTAAGGAGGACACAGTCGCGTCCTTCTCTTCTATCGGCCCGATGCTGGACGGACGGCAGAAAC
CGGATCTGGTGGCGCCCGGTATGTCCATCACCTCGTCGCAGTCGGAGAAACCAGGCTCTAGTATAAAGTCGTCGGCAGTGTGCTCGCTACAGGGCACGTC
TCAGGCCACGCCTGTGGTCGCCGGGATGGCTGTGTTGATCTACGAGTGGCTGCGTGACGGATGGTGGAAGAACGGCGTGGCGGACCCCACGTACGGCATG
GACACGATCCCGGCGTCTTTGATCAAGGCGCTTCTGCTGCACAGTGGAGAAGCCATGTCTCGACGGCTCATTGAGCCCAGCACGGGCGTCACGTCTTGCG
TGGCGTTGGAAGCCGCGGCCAAGACACTCACGTCGTACCCGGACTTCAACCAGGGCTACGGCAAACCCACGATGCTCAACCTCGTGTCGTTCATGGGCGG
TACTAACGGGTCGTCTTCTTCGTCGACTAGTAGCAGTAACACCATCTACTTCTTCCCCAACTCGTCCACTGGATCCGAGCCCAGCGTGACGGAAGGCAGT
GAGGTGACGTTCCACTTCATGCTGACAGCCAGTGTGAATCTCCGAGTGACGGTCGTGTGGACGGATCCTCCTGGCTCTGTGGGCAGTAAGGCGACGTTGC
AGAACGACCTGGATCTGACGCTTAAAGTGGCCAACACGACCGCTGTCTTCTATCCGCTGTCCGGGAACGGGTCGCGTGACTCGGTCAACAACGTAGAGAT
GGTCGAAGTTTCCTACGACGACGTGCTGGACGCCGTGACAGAGGCTGGGATGGTTGTGGACGACGGCTTCATCTACGTGCAGGCAGTCGTGAGTGGCCAC
AGTGTCAAGGCGGGCGAGAACGCGACGACTAGCGGCCAGAAGTTTTCGATCGTGGCGTCGTCCACTCCGTCGTCCACGTCCATGACGTCGGCTGGTGACG
GCGACTCAGCCTTCTGGCAGCCCTGGATGACGATCGGTGCTATTGTTGTGTGTACACTCGCTCTACTCTTTGTGATCGCGTTGGTGTGGCGTGTGCGTGT
GATGATGAAGGCGGACAACCTCAAGGCGGATCACGCAACGCCCTCGGCTGCTGCTGCACTCACGGGCGCGGCGGGTAGGAGGAATCTCAATCGTCGGGAA
CGCAACAAGAGAGCGAACGAGGAACGCACAAGCGTCCCCCATATTCACCCGAACTACCGCAACGTGGAGGCAGGAGGCAGTTTACGTCCTGCTCTGGAGG
AGCCTTCGGCCATGGGAAGTCGGCGTGCCTTTGATCCGTCCGCTGCCGGCGTACACGAACCCAGTAAACGTGCGTTTGACCCGTCCACGGCTGCTGTACG
TGAGCCCAGTCGCCGCGCCGGGGCCCCGTTAGAGCCTCCTCAGCCTACTTCAGCGCGAAAAACGAGCCGTCGTGCTGCGGCCGCCTTAGCGGAGCCTCAC
CCTCCGAGCAAGCGGCGTGACGGTAGCGACCGTGGACAGGACCGTAAGCAAAACGATGGTAGTGACAGGGGGCGCGTACGTAGTGAGCGAAGACGGCAAC
GAGAGCGCAGTGATCGCGCTGATGGCAGCGATCGAGGACGCGTACGCAGCGAGCGGAGACGGGAGCGGGAGCGCAGCGATCGTAGTGATCGTCCTGACAG
TAATCGTCCGGACAGTGATCGAGGACGCGAACGCAGTGCCAGGAAGCACGAGCCAGCAAAAGCTTATTCGTCGCGACGTAACGAGCCCCCTATCATTCTG
TACGAGTGAAGCTCAAGATCATTTGGATAGTGTGAGGTCATTGTAAGAGGAGACGTTGTGCCGTACATACCTCGGCGCGTGCCTAACTCAGTGAATTATG
GTAATTTGTCAACGTAAAAAAAAGATTATGATATGATAGTGGGTGGCTATTATTACGGTGAACACAGGACATCCCTCTTTTTGGATTGTTCTGACAGCTT
CAAGGGCAGACTTATTTCCTTTTTTCTCGCAGAACTCGACTTTGATTACCACAAAACAGACCGGGGTCAGAATTGACTTTTTTTTCAGACATTTTCTGGT
ACCATACCTTCTTTGGCGACCATTATCATTTCGAAAATGGTCAGCTATTTCTGAAATGGTCAATGACTTACTAAATTAAGTATAAATCAAAGTGGGCTAA
TGTATTTATTGCAATAATTGGTCAAAATACCATATTATTGATAAGTCCTGTACATATTGCATTCATACGCTTTCGTAAGGCAGCAATACAAGCTGGAGGT
CATGCGTAAGGCAGCGGTCTTACGATTTCTAAGAATGATGAAAAGCATTGCTCAGGTTTCTATTGGCTAATCACTGGGGTGGGCATCAACGGCCTTTGTA
TGGGACAGCGTAAGAAATCTGCCTTACGTAGAAATCAGTGATATCATTGGCAGAAACGCGCTCGATGAGCTCACACGGAATCGCTCGTGATCAGCGCCAG
GAAGTGGACGCACCTGGCCAAGAGAGATTAGATGGGGATGGCGTTCGAGCACGGTGCATTTCTGACGGCACCATAGCCCGATACCGCAGCTATCTAAAAG
GAATTCGCCAATGGGTGTTAGCAAACAAAAGCATAACCAACCCTCAAAGCTTCTTCGACGCGTCCGGAAATCTCGACCCGAGGAAGTTCAAGGCCAATGA
CTTTGAGGCGATCCTCGTCGACAAGCAAGATAAACTGACGACTGGTACCCTCGGAGGGTATAGGAGCGCAATGAAGGATCTGTATCGACGCCTCCAGTTG
CCCCTCCCAAGCGAGTACGGCGAGAAAATGACAACGCTTTTTTCTGGTCTAAAGCGCTTAGAGGCTGATCGTGACCAAACCGGTCAAGGACGCGAATCTG
GCAAACGGCCTGTAATGGGGTTACATGGTGTCGAACACACAGGGGTACGAAGTACCTGGAGAGTTAACAAACTCTCAGTACATAAGCTGGAGAGTTAACA
AGGTCTCTCAGTACGTTGGCTGAAGGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAACATATACATTTAACCCTAGGCGGCTTG
GCCGCAATAATAGTAAATAAAACACTTCTGGTTTTGAAGCATAAAAGCTAAGGTATTAACTTTGAGCCCTAGTCTTGGGCTGTAAGCGTCCTTTGGATAA
GGAACTTAATATTAGTGACTCTTTGAGTCGAACGTCTT