Description :
From Genome Similarity Track
Location :
Scaffold_726:2124- 6190
Sequence
4066 bases(100 bases per row)
CCCAAGTAGGCTCATCGTAGCCGACCCACTTAACTTTAAACTTCCGTTGTGATCGTGACGTACTCGTGGATAATGGTAGCTCATCGTCGAGAATTGCTTC
GACTTCATACTGGTTCGTACTTGTGTCTGGCTCCCCGCTGTCTTCAGGCAGTAATTCTTCGTCAAAGTCAAATCGCTGAATCTCTTCGAGGTCGGCGATT
AGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGCCGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTCCA
ATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGACCAACTTCTTGGTCAGGCCCGACTTGACTCGATCCATAAA
CAACCAGACTCGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATCTT
TTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCCCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCAAATCGAAGTGCCACTTCTCGTTGTC
TGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCTTTGAGTGTAGACTTGGC
GTCCCAACCATGTACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGTCG
GCTTGAAGTGGGTTTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGTAG
CTCTTGATGTCGACTGCATCATCTCGGAGAACTTTTGGAATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACTG
CCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCCCCGGTGTCATTCATAGCCTTAGCGATAACGAATCCCGTGAAGTGGTCCTGGAACAGC
AGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCTGGCGAGT
AACCTCTCAACTGTGGCTTGCTCTTACTGGTATTGCAGTTCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCGGC
CTTGACTCGGTGATAAGTTCTGACGATGCCCTGATGCCCTCCTTCGATCGAGTTGTGACAGTTATGAAGTATTTCGTCGACCATAGTTGACGGAATCACC
AATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCCAGTCGTCGAGCTTCATCTCGGCGGTATAACAAGCCGTCTTCGCTGAGTACAAAGACTTCTGCGA
CTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTTCTCCACTCCCACCTCTCAGGTACGCCTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCCT
TCGCGATTCGTCGTCTCCGCTCAGTCTGTACCGTCACTGGATCAATGTCGTTGGCATTCTGAGCTGTCTGGGCTGACTCCATCTGCGACCCTGTTTCGAC
ATTCGGGGTCGTGTGGTTAATCCGCCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTTTCAAACGCGGATTCTCCAGGATTGGTAGAC
ATGGCTTCATGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTGACTGCCG
TGACAATCGGTGTTTCCGCTGGGTTGTCTGTGGCGTACAGTTCTTCGGCTACGCGGTTAATCATTCTCAGCTCTGCTTTCCTATCCGTCCCAAGAATTAC
TCGTCCAGCTTTAGCTTCCAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGTTTC
GTGAGATCCTTGTGCCGAGCTAGTTCCACTTGCAACGTTTCATTCTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGCGTCGAGCGTCTCCCCTCCAAAACAGA
TATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAGGAAGACTGGTCTGGTTCTCCATTAGCAAACATGTCGCCGTCCGGTCCGTTAACCAGGTC
TTGGACCGGATCGTAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATAGCTGACTCCGCCGAGCTCGACTCGCCGT
GTACCCGACTCGGCTTCAGCAATAGCCATTCGTTCGGCAAACAGCTGCCATCCTCCCTTTGGTTGAACGTATCCCCATAGAGCGTTGTCGATCAGTCGCA
GGTAAATCATAGGCGCATTCTTTAGTCCAAACGGCATGCGTAACCATTCAAAATGTCCAAGTGCACAGACGAACGTTGAGATCTGCCGAGCTCGGCGTGT
CATCAAGACTGCCCAGAATTCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAACTCTTCAATTCGGTAAGCAGGTCATCAACCAGTGGCATAGCGTAT
TCCATCGGCGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGCCGAATATCCACACCATTTTGCTTGAGCACTATCCCCACTGGCGAGGCCCAAG
GGCTGCCCGAGAATGATATCAGCCCAGCTCGAAGCAGCCCCTTCAACAACTCGTAAAATTTGCTCAAGTGGCGGAGAGGTATCCGCCGAGCTCTCTGCTT
AATGGGTGCGTGTCCTTGAACATCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATT