Description :
From Genome Similarity Track
Location :
Scaffold_1995:2124- 3340
Sequence
1216 bases(100 bases per row)
AGTACCACGTCGACGCCTGCACTATGCGCCATTACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGC
AAAGGTCAAACACCTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTG
CCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACG
AAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTGCCTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGTGGAG
CACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGTCAGGAAACGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCG
GAAGAGCCTGCGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGTGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATC
TGGCTCGATCCTGGATGGATTGTGTCAGATCACGCGTAGGTCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCTTCGGACCCTCGCCCG
CGCTTCCAGCATGGATGCCCCAGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGAC
GCAGCTTGGCTGATCCTCGGCGACGACACTGGGTCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGAATA
CTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAGACGTAATAGATCTTTGACTGCCAC
CAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAG
TCGCGTAAAGCCTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTT
ACTCGTTTTCGTTTTC