Description :
From Genome Similarity Track
Location :
scaffold_60:21235- 24040
Sequence
2805 bases(100 bases per row)
CTTTTGTAGCACCCTCACAGTACATAGTTGCAGATGACGATGATACTGGTATGTCCAATCTAACATACACTCTCAGAACTCCAGAATTTCGTGATATATT
TGAAATTGATTCGTCTACTGGATACATAAGGCGAAACGTCTCTGGAATCGATTATGAGACTCAAAATCGCTATGAACTCCAGGTTGGAGTCGAAGATAAC
GGCAATTTACTTGCACACGCCACAGTAATGGTTTGGATTGTGGATGTAAACGAACCTCCCATGCAGGTATCAAACTCGATTTTAAAAGTGTCAGAAACGG
CGACTGTCGGCACTATCGTGGGGACAATTAACGTTTACGATCCCGACAAGGACAATTTCGCTGTGTCTATCGTCGACGGCAACCATGGCAATGCTTTTTC
AATCGAGCTTAATACGCTCGTAGTTGCACACGATGTATTAGATTACGAAGCATACGCAATGTACTCGCTGAAGCTCTACATAAATGAGTTACAGGACCTC
GACCCCCTAGCATCGTATGGAAATATCGTTGTCGTTATCTTGGACGAAAATGAAGCTCCCGTCTGCAATAATCAAACAAGAGCAGTTCCTGAAAATTCTC
GTATTGGCACTCCTATGGGCAATATTCTCCAGGCGGTAGACCCTGATTTTGGCCAGCAAGTTTCATTTGCTATTGTTGATGGTAATAATAACAACTTTTT
CGCGTTGGACTCGGTTACTGGACAACTTAGTGTTGGCGAAGGTCCATTGCAGAGTTTTATTGGATGTTTCTCACAGCTTCAAACCGGGTTGGCAGGGCCG
TTTAGTACATTTCGGGGGGGCAAACCTTTGAGAGATTGCTACAACATGTGCATTGGGTCCCAATTCATGGCTCTAGGTTTTGGTGCAGAATGTTGGTGTG
CTACTCCAGCTATAGTGGATTATAAACTTACTTCGACTCTATGTGATACAGTCTGTGATGATGCACCAGACAAGAATTGTGGAGGAACGAACCAATATGC
AGTATACGAGATCGGGGCTGTTTTGGACTACGAGAAAACGCATAACTATGTTCTTTTGATGAGTGCACGTGACGACGGAAGTCCTGCCATCAGTACAATG
TTTAACGTCACAGTTGATATCATTGATGTCAATGAGCCTCCGAGACTCGTGACATTAGACGTGTTTATTGACGAAGGAAGTCTCGCTAATGTTGATGTAT
CAGGTGCACTAATTGTCACTGATGACGATATTCATGATACCTTTGAGTTATCATTCGTGCATTGCAATGAGCTAAAGTGTCCATTTCAATTTAATGCCGC
GACGAGACAACTCATCGTAGTATCTGAACTGGACTACGAGGAAAAAAACGTTTATTTGCTCACATTCAGGGTGACGGATAGTGGATCACTGACAGATGAT
GCAAATTTGACCATTTTTATCCGGGACATGAATGAGCCTCCTGTGGTTTTTGATGCCGATTTCGAGTTACGAGAAAATTCACCAAATGGTTCGTTTGTTG
GGCTTCCAGTCCGTGCGTTTGATCCAGACTATGGCGACAGTATTGACTACTTTATCGCATCTCAAAGCGTGGATGGTTGCTTGAAAATTAACCCACTATC
TGGACAAATATTTGTTTCAAAAATGGCGTGCTTTGATTATGAATCATTTCGGTTCGATGCGTTGGAACAACCAAGCTTCGCTGGTGCTATTCGTAGGCAA
GGTGACGATCAGCTAAATATCACGGGGGTTAATTTCTTAGAGTACTCGAAAAACCACACAATAATCCAGCTTCTGTACACGCGAAGTGTTCCGGTGTCAG
CATCAGATTTCCTGGTACGAGAAGCAGTATTGGTCCGTGTGGATGTAACTGGGGATGCATTTTACGCGGTCAACACATCGGGCATGCAAAGTAAGGATGG
AAAAACTGTCACCGGTGCTCTAACGTTCGAACTCCCTCGACTTCGGAGCAATCATGTTGTTGATATTAAATTCAGAAGTACAGAATGGTACAGACTCTTT
GACGTGGCGAAGTTAAGGAAGACATTTCGCGTGGTTGTTTCAGTGCAGGATTCATCGCCAGCAGCTTTGACCTCAACAAAAACATTTGAAATTGCACTCT
TAGACCAAAATGAGATGCCTACTTTACAATCAATTGGAGACCTCCAGGTGGTTGAAAATGCTCCAACCGATTCCGCTATTCAACCTGCGGTAGCATCGAT
GTTTTATGATCCTGAAGGATCAAGATCGTTGCAATTTTTCTTGGTAGATCAAAGTATACCTGGCACGTTTTATTTTGATTCATTAACTGGATATATACGC
GTGGGAACCCGAGGGGTGAATTTTGAAGGAAAGCCAAGTCATTCGCTGAACCTCACTATTGCTGACGATGATATTATCACGAATTATGTCCTCACAGTAT
CAGTCGTTGACTCAAATGACCCACCGAGCGCAACGTGTACTCACACTCATGTCAGTGAAAATGCACCGATTAATACGCTTATATTAGGTGCCATTGTTGT
CACTGACGAAGATGTATCTGATACGGTTTTCACGTACCGCATCCTAAACGAAACCCAAACATTTTCTGTCGACAGACGTGGACAAATTATAGTGAAAACG
GTTCTTGATTATGAAGTTCAGCAGTTCTACTTTGTTGCGGCGGAAGCTACTGATCACGGTGGATTAAGTGGAAGTTGTGTGGTAGTAGTCGAGGTAATCG
ATATCAACGAACCCCCATATGGACCAATAACTTACAACGGTTCAGTATATCAGCACGCTGCGTTGGGCCAACAAATACTGAAATTGGGAATACAGGATCC
AGAAC