Description :
From Genome Similarity Track
Location :
Scaffold_107:212321- 220925
Transcript NameFunction/comments
Hyaar_Emoy2809706DNA repair and recombination protein RAD54 putative
Hyaar_Emoy2809707hypothetical protein
Hyaar_Emoy2809709sialin-like protein
Hyaar_Emoy2809708sialin-like protein

Sequence
8604 bases(100 bases per row)
TTCCTACCAATCTTCATCGTTCTGGTCGCCTAAGTCTATTATCTGAGGACGAGACCGCCGATAACGAAGGCCACAGCTTGAGCAGTTAAGACTGCTTGCT
GGGTTAATCAACGTGCATCGCGAACAGCTCCATGCGGACTGAGCCTCGCTTTCTTTGCACTCGTCCAGCGTACTTGTGGCCTGATTACGCACCGAGCGCT
GGTCGTTTAGAACATCTTCGACGAAAGCATCCTCGTCATCGGAATCCGAGAATTCACATACTTTTAACTTCGTTGGGGACCAGGAACTTGCGTCGACCTC
TGGCGCGAAAGACACCTTCCTCTTCAGCTCGGGATGCACAGCTTGGACGGGAACCGGGTGGGACGATATCTCTAAAGACGAAGCTAGCGCTGCAGAACGC
CGGGGCTGTGGTTTCGAGGCAGACGGGATATCGACTTCTGTCCTTATAGATCTTCGCCCCGATACACCATCATACGCGCCTTCATCTCCACTCTCCGATT
CACTCTCGCCAAGAACTTCGTCGTTATCGTCACCTTCCTCGCCATTACTCGAGAAGTCGCTCTCCGATCCATACGATACATCAATAATCGATTTTTTCTT
CGACTTGGAGCGTTTAACCCTATTTTTCTCTTCAGCTGACTCTTTGTTCGTGGCTTCGATGATTTCCAGACGCTTGCGCTTTCGCTCCTCGTCACGCAGC
ATCTCCTTTTCACCATTTTCAGCTTGGTGTTCCTGAAGCAACTCCCAGTCAATGCGGCAGCTGAACGCAAAACTCACCAAGTCATCGCGCACTTGCTGAA
GAGCCGTTTGCATCACTTCGTCGTCGACAGAAGCATAGGAACGGTGATGACCCCAACTGTTCAAATCTTCCTCTGGCGGCATGCCGATTTGTGGGTGATA
GCCCTTGGCTACGTCCTTAGAACTGTCCTCATCACTTGTCAAGTCTTTTTCTGGTGAAGCTTCGCTTCCGGCCACCTTCTCACTCTCATTGTTGTCATCA
ACCGTGACTAGAGATGGAATGTCCTCGACACCACCGTTGTCCGCATCACGCCACTGGCAACGGTCGCACTTTAACTGATCATGAGTATCAGACATGGTGT
CTTTCCGGAACACGAATAGTCGCTTGAGATCCTTCGATGACAGCGAGTTAACCTCTTCTTTGTCATCAACAATGTTCTGAAGACCCTCTTTGGAAAGCTG
TCGTTGAAAAATCTTCTCCTCAAGTGTCCCTGTCGCCAAAAAGCGGTACACAAAGCACATTTTTTTCTGCCCTTCACGCCACACACGAGCTGCGGCTTGC
TTATCGGTCGCAGGATTCCAATCAGGATCAAAAAGTACCAAACGATTCGCGCCAATCAAATTCAAACCACACCCGCCAGCTTTACTCGACAGCAAAAACG
CAAATGAATTCGTGGACGGATCATTAAACGTGTCGACTAGGTTCTTTCGCTTTTTAGCAGACGTGCTTCCATCCAACCGAACAAACGGCAAATGACGCTC
CTGGCAGAGGGTCGATACAACATCCAGCGTCTGAGTGTAGTTGGACACAATTACAATACGGTCTGTCGTTGTCTTCCTCATCGAAGACATTAAGCGATCA
AGCAAAAGCATCTTTCCAGACCATTCTGGATAGCATGTGCGTCCCCCAAAGCCTCCCCGTCGATTTCGACCGGTATCCCCTCCACTGTTTCTAGATTCCT
TCGCCGCCGCGAAGTATTGCGCACAATTGCCGAATCCGGGAAGTTTCGTATTGGTTTTTCCCATTTCGTCAAAGATCAGCAGAGGATGGTTGCATAACTT
TTTCAACGCGGTAATCGATGACAAGACATTGACACTCTGTCGCTTCATCATATCACGACATGCACTCGAGGACAGAAAATGCATGTAGAGCTGTTCCTGC
AGCGGCGAAAGTGGGCAGCAAATTACCTGCATTAGCTTCGGCGGCAAATGTTTCGCGTTCAGAATATTGCCTCGACGTAGAATAAACTGGTTAACAACTT
CACATAGCATCGCTGAGCAAGACTGCGCCACTCCTCGCTCACGATCTGTAGAATCCGGTTCTCGTCCAACTAGGATCGGCCCTAAATAACTCTTCCGAAA
CTCACTTGGTGTGCCTAAAATGTTGGGGTTCGTGAAATCCACCATCGCAAAAAACTCTTCCAGATCATTTTGCATAGGTGTACCAGAAAGTAGCACCCGT
CTACGACATGCCAGCGAAGACAGTGCTTTGTTGATCTGAGAATTGGCATTCTTCAGTCGATGTGCTTCATCACAAATCAGCAGCCCACAACAGGCTGGCG
TAGCGGCAAACTTCTGCGCGTGCATTCGAAACGTCTCGTACGAAATGATAAGCACCTGAGCTGAGAATCCGGGTCGTGGTCTCTTACTTCCCTCGATAAA
CTGACTGATACCTTCAATCACTGTCTCACGCTTCGCTTCATACAGAGCCACCGTTTTTAAGCGTCCATGCAGCCACTTGACAATCTCGTCATCCCAATTC
TTCACCAGAGACGTCGGACAAACTACAATTGCTCGACTCAGCGTCGGCTGGATGTCCATACCTGTCGTCAACAGCGTATACATCAACGCGATGCTCTGCA
GTGTTTTACCCAAACCCATGTCATCAGCCAAAATGCATCCTTGTCCTTCGAATCCCTTGATTTGACACACACAGTCAAACATGAACTGTACGCCTTCTCT
CTGATGAGGTCGTAAGAAATTGCCCACAATTTCAGGCACCACCACTTTACGCTCTGGATCGGTCTCACTCTGCCACAACACCAGCGGCGGCGGAGCATCA
GCTACTACAGCAGCAGCAACCGGTTCTTCAATTGATGACACTTGCAGCTCTTCTCCAGGCATCTCAATTGCGTCCACTTCCACTTCCACGGGCGGCAAAT
CGTGGCGAGCCATTGGCTTAAACACAACAGGACCCCAGCGACGTCGCATTCCCAGCGTCTTGACATGCAGCAGGCGGTAACTCTCCTGCGAGCGAGCATC
ACTCCCACACGGAGACTTGAACGGACATCGCACGCGTTGCGTCCGTCGCTCTGGCTCCATCACTAGAAACGACAGGAACGGAAGTCGCCTGACGGACAGC
GGCTCGCCAGTACCTGCTTTGTTCACACCTTTATCGTCTGCATCTACGTCTAGATTTTGGTGCGCATTATTGCGTATGGACGCGGTTTTTACCGGTAGCA
CGAACGGCTTGAACTGCGCGCCGCCGCCGGTACGTCGACGGAGCATGGCAAGTGGTGAAAAGACTGCGTCGTGTTTAACGAGTGTTTCGGATTGGTCAAA
AACGAGTGATGGCCGTCACGATCACGGCAAAGGCGGTGATTCGTTGTGATTGGATGTAAACACAATTTGTCTATCCACGCATTTGCACCAATCAGACGAC
ATCGAACGCGATCCATTAAAAACGCGGCGAGAGAAGTTACAGCAAAATTTGATAACGTACTCTATTTCAGGAAGCGTTCGGAGTGGTCATAAAGCAGCGA
CGATCCGCACCGTCACAGACCGCGCGGCCATTCGTTTCCATTGGATGTAAATACATCATCGACTCGTTTCCACCAATCACACATCGTCCATTCCTGTGCG
CCACAAAAAAAATACGTCAATAAACAGGACGATACCTTCCTCGGGTCATGACGTTCCGGCGAGCGCTGCTGCATCTACGCCACCTCACGCTGCTCGTCCA
CACCACTGTGTCTGCTTCTACTGACGCATCTTCCTTGCCACGTACAGGTATTAAAGCTCGGCATTTGGCAGTTCTCCCGTTAAATAACGGCCAATGCGCT
GCCCTCGACCGACTTATTGACGTATCAAAGCGCTCGTGGCGACTGCGCGCGGTTACACAGGACGTGGAGCACTCACTGCCTATGGACCGAGGAAGACGAT
TTTACAACCGCCGATTGGTGGAAACTCTGGAGCAGAGCGACTACAATCGCGCGTGGGGGATTCTCGAGACGCTGCATCGTCGATATCCAGACAAGAGCGT
GCTTTGGCCGTACACGTACAACCTCATGCTGCGTCACTATTGCAAGCAGCAGAAGACGCTGATGGATGAGAACCTGATGCGCGTGTTGACGATGCTGGAC
GTGATGGTGGACCACAGCTGCGCGAATGAGACGAGCTTCCAGGTTGCTATGGCTGCGTGCAGTCGCGCGCGACATTTACGCAGTGCTCGACATGTACTGG
AAAAGATGCAGGAAGCTGGTGAAAATCCGGATGCGAGGATTTATGGCTTTTTGATCAATTGCTGTGCTAGGAGGCACGGGCTGGTCAAGACAGCAGAAGA
GTATTTTGATGAAATGTTGGATGCAGGTATAAAGCCGACGAGTTTAGTCATCAATGCTTTGTTGCGAGTGTATTCGCGCGATTGTGAACGATCGAAGGTC
ATGATGGAATTAGTGGATCGTGCGCGTAATGAGTTTGGTTTAGTTCCCGATACCGTCACTACCCGAACGATGGTGTACTACCTTTTGCGTGAAGGTGACG
TCGATGAGGCTGTGGATTACGTACGAAACGTTGAGCGATTTTTTGTGTGCGACGTGACTGCAAGACTACCTGTTAAACGCCAAGTTGTGAACGCGCTGAT
TGATGCTTCGCGTCAACGTGGCGAGTGGGATCATGCCGATTATGCACTCACGCTTGTGACAAGAACTGATGCAACAGGCGTTTCGGCTGCTAACACTATC
AAGGACGTGCAAAATTCAAAAAAGCTGGAGACATTGGTTGCAAAGCGTGACACAGCATCAGTGCCTGTAGTCTGGGCTCAGGCTAAACAAGATTGGTCCC
AAATGACACGTCGTGAACAACATTCGTATTTCTTGCATCGGAACCAGAAGGAGAGTATTGAGCGCGCATTGGAAGTTATGCGTCTACGCACCCCTCCGTT
GATTGCGGATCGGGCTATTCAGAGACTTTCTCTTAAGTTGGAGAGCAAGCTAAGGGTACTAGATGAACTGGTTTGTACAGGGACCGCAAGTGCAGCACAC
TTTAACACTGTACTAGGTGCCTGTGGGAAGCAGGGACAGTTGGCCAGCGCAGTGTCTGTTTTTACGAAGATGAAAAAATACGCCGAGGCCACGCCAGAGT
GCGCTCCAACATCTTGGAGCTACAATGCGCTGCTAAATGCATACGCTGTGTGCGGCGATGTTTGCGGAACGGAATCGATTGTGACCGAGATGATTGAGAA
TGATGTGCAACTCGACCAAGTGACTATGAACACGATATTGAAGGCGCACGTAACAAGATTGAAGAATAGTCCATGCGGAGATTGGCGAACGCATGTTGAC
ATCACGATGCAAGCGCTTTCCTTTTTCGAGTGGTGTACTGAAGACCGAAAACTTGATCCAGGAGCGGCAACGTATTACTCGCTGTTTCGGTTGTTTGCAA
CATATTTGGAAACATACAGTAAAGCTGACTACGACCCGGTCGCTCAAAGTACAAGCGAAGAGAGCTGCAACGAGGAAGTAATGGAAAGTCAGGACGATGA
ACTAATTGCGTCGATGGGAGAGTTCATATCCACTACTTGTCACGACGCACCTCCTGGGTCGCTGGATATTGGCGTGTTTAACAACGCGTTTAACTATTAC
TGTCAACTTGGTGACGTGGACAAATCATTCAGACTATTTGATACAATGAAGAAACGTGGGTTCCAACCTGACGATACAACTCTTGGGTTGATGTTTGCGA
CATGTGCAAGTCAGCAACAGTTCGAGGTAGGCTTACGCTTTTTGGACTACTTAATGACTACCGACGGGTACAAGCCTACCCTCAAGATACTTAGTGGTGC
TATGCAGCTCTGCGCAAACTCAAAGAATCCGGACGGAGCATTGGAGCTCTTTCGAGCTATTGAAATGTCAGGTACATTTTCGCCCACGGTGGAGACGTAC
GAGCCATTGGTGTTTGCATATGCTCGCGTAGGAAACGTGACTCGTGCGTGGGAGATTGCGAACGAGATGGAAGAGAAGCTTGGGAGAGCGTCGATAAGTA
TCTACAATCGCATTTTGTTGGCTTGTGTGGAGGCTGCCCTTCCTGGACGCGCCTTGGAAGTGCTAGGTGTGATCCGGCTGAAAGAGGGAGTGTCACTCGA
CGTCGTTTCGTACAACACGGCTCTGGAAGCTTTTGTGAGAGCAGGGGAGCGGGCTGCATGGTGGAGGAAGAATAAAAGCAATTGGGAGGAGGAAGATCTC
TTTTGTGATGAAAATGTAGAGTACGATACGAATGAAGATGGCATGGATGATAACAAATATGTTGAAAGTGACAGTATTGTAGGAGATCATGCTGTCGTAA
AAGATGGTCCAGCGAGCGCCCATTCAATTGATGAATGTACTGTGAAGGCAGTGTCAACTCAAGATCACGAGCATGGACAGCATGAGAAAGCTGCTTGGGT
TCGTGAAAGCGTGATGAACCTACTTGATGAAATGCGGCAAGATCGAGTGAAGCCGGATAAGACAACGTTTGAGCGTGCGATAGCCGCATGCAGTGTAAAT
CAGGACTCGGAAGGTGTGATCTCCGTATTTGATACACTCATTGATCGCAGGTGGGGCGAAAATGCCGTTGAGTTAAAGAGTGACCTTGTGACAGAATCTA
GCTTTTCAGCCTACCTCGTTGAATGCACCACATTACGAGACAAAGACCGAGTACTTGAAGCTCCAACACTTCTTCACAAATGGCACACCGCAACGGGCCA
AGTTCCGCCAGTATTCGTCGTGATGCAGATGTTAGACTCGTTGGAAGATTTGGGCGAATGGCGGCGAGCTGTTCGCATGCTTCCTGAGTGGCAGACGTCG
TTCGGTGTGGCACCTAGCGTCAGTGTATATAATCGTGTCATGCGAATGTGCAATCGCGCTGAAGAGTACCAGCTCGTGGCTTCAATATTCGCTACTATGC
AAGACACCGCAGCCTACCGTGTTCATCCCGATGCAGAAAGCTATATACAACGCATTTATGCCGACGAACAGCGCGAGAATTGGGTAGCAGCCACGGACCT
GTTCGTAGAGATGCAGAAGAGATGCCCACGCGACGAGATTTCACACCATCAGCTGCAGAAAATCGCATTGGGTCGATACCGATTGCGCCAAAGTGAGACG
TGATGTATTGTCTCACAATGTCCTTGGGCTCATTTTACTCTCCACATCGTGCTGTTGCTCATATTTGGGTTTCGAGCAAGCTCTCCTCTTCGTCAAGGAT
CGACAAACGAGGCAGGCTGAAACTAGGACTACCACGAAAGCTACTTGATGTTGTGCTGCTACCGTTGTACCCTTCGTCGTAGCGAGGCTGCGCGTAAATA
GATTCATCGGAGGCGCAGCAATGGAAAAACATGGCGCCGAAAACGAGGACAAGAGCAGCAACTGCAAACACGAGGTCCCATGAACCCGTAGCTTGCAGAA
TTGCGCCTGTGACCATATTGCCGATGATGCCGGGGATGGTTCCGAAGGTATTGGAGACGCCCATAATATGCGCGGCATGGTTTGGCGCCACATCGATCAT
GTTGACCCAGTATCCAGCCATAGCGGCTCGACCGGTAAACAGTGTCATACACAGCAAGGCAACTGCTACGAGAGCTGAGTTCGCAAAGCGCAGCAGGAAG
AGAAAGAAAGCGCATCCGAGGAACGAAAAAGCATTCATACCTTGGCGCACATGCAGTGCGCGATAGCCGCAAGTGAGTAACACATCTCCTAGTCGTCCGA
ATAGTAGAGTCCCCATGTAGCCGCATATGTAGGGCAGCGCCGCGGCAAACCCGCCGTTCTTGGTCAGATCAAGGTTCAGCACTTGGCTAAAGTACTGTGG
GATCCAGCCCAGCAGGATATACCAACTGTAGTTGTAGCACATGTGCGCAACATAGATTGCCCACGCAGGTCGTGACGTTAGTAGCACACGCCAGTTCAAC
GCATGGGTGTCCAGCTCGGCGCGACGTTGGTGGGTGGTGTCATGGTTGACAACTCGGTTGCGCAGGATGAACGTGCGTTCCTCCACGGTGATGCGTGGAT
CAACTTCTGGGCGGCTTGCTCCCTCAAACACATATACCACAACCCAGATAAAGCTGAATACGCCGAAAGTGACGAAAATGCGTTGCCAACCACTGGCTGC
CATTATAGCAGGTGAAATGACCAGTGCAGAGATGGTGCCCAGATCGGAGCCGCTTGCAACTAGTGTAACGAGACGACTTCTTTCCTGAATTGGGTACCAT
GCACTTGACAGTTGGTGCATACAAGGGAACAAAATGCCTTCTCCAAGTCCCATCCCTGCTCTCGTGAAAAACAGACACGTAAGGCATTTCGCCACGACCA
CTGTCGACAAATCCTACAATAAAACATGTTCTCAAGGTCAGGCTGGCAGATACTTCTTCTCGAATGTCCACCGCGCTTCAATAGGCGGTACCTTCATCAT
CCATACAACTACTGCAATGATCCCCATTCTCTTTCGCGCCAAATCTCTCAATTTAATACCCCCCATGGATCTAACTTCGAAGTATTAAAACACATGACAA
CAAAGTCTTTTGGACAGCATGGCCAGAGTCCACAGACATACATACTTGAGTGCACATGTAGCCATAGAAAAACTCCTCACAGAACTTTCACCCTGCTGCT
TCCT