Description :
From Genome Similarity Track
Location :
Scaffold_1586:2123- 6539
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1586-snap-gene-0.1Gene of unknown function
Pytar_ATCC12531maker-par_contig_1586-snap-gene-0.2Reverse transcriptase
Pytar_ATCC12531maker-par_contig_1586-snap-gene-0.3Gene of unknown function

Sequence
4416 bases(100 bases per row)
GACTTCTTGACGCCGGCCGGGATTCGCCTCGACTTGGCCGATGGAGTCGCTCTGATGCCCGACGAGATCCGAGTCCAGTTCGAGGGACGTCGACCACACT
ACAGTGACAAGGCGGAACAAGTCAGAACGCGGTCTGGTGAAGCGGCTCAAGTTGACTTGCATCTTCGATAAGCCGGTCACGATCGCGTCGCAGACAGTCG
TCGGGATGTGGTTGCCNNNNNNNNNNACTCGAGACGCGTCGCATCGCCGCTGCTGAAGCCGAACTAGCGCGTATGCCGCCTGCCGTTGAGCGTAGCACCT
ACNNNNNNNNNNCCGCGTGCTGCTGGCTACGTCTCGGTCGGGTCGAGGAGATACGAAGAGTGGTGCACGCTCACGTACGAGGCCGAGCCGGAGCCGNNNN
NNNNNNACACCGCGTGCGATTCTTGTGCGGCCGTCGAGTGAAGCTCGTGTGAATGGAGGTCGTGGAGTGCGGCCGACGTCGGAACGAAGTGCCGGCGACC
AGGGAACGAGCGAGCGTGAAGGTGATGGGCCGCCAGGAACGTGTTCAAGGAGTGAGGTTGTCGCAAGCGTGAGAAACAGTGCGGGCGATATGTCCAGTGG
AGGCTCACGTGGGACTCGCTGTGACAACACCGAGTCTGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCATCGCTTTTGTCGA
AGCCAAGTCGCTGATGGATATGAAGATCGACGAGACAAGTCTGTGAGACGCCGTGTATGTCCACGAAGGTGGAGATCTGTCGGTGGAAGAGATCGAGGGT
CAAATGGTTCTCATCCCAGAGATCGATCCCACGGACGATATCACTCCAGAGGATATCCAGATCGCTGTCGGAGAAGACGTGCCTAAAGAAGATGTTGAGC
GAGTCCGCGAGATAATCTGGCGAAGGCGAAAGTATCTGATGGGCAAGGGCAATGCGAAGCCGCCAGCAGCCAAGGGCGTCGTCTGCGATATCGACGTGGG
CGATACTAAGCCGGTAGCACAGTCCTGTCGGAAGGTGCCACCCCAATACGTTGAGAAGCTGTACGAGCTCCTCAAGGGTTTGCTTCGCCACGAGTTCATC
CAACCCTCGACATCGCCTTGGGCGTCTCCCATCGTCATTGTCGTCAAGAAGAACGGGATCGACATCAGACTCTGTATTGATTATCGCGTCGTCAATGCGC
TGACACGCTTGATGATCTATCCAATGCCGGTGGTGCACGATCTCCTCGAAAACCTGGGCAGTCTGCTTTGGCTTTGCTTACTCGACATGGCAAGCGGCTT
CTGGGTCGTGAAGATGACGGCACGAGCACGCGCGATCTCGGCATTCGTGACTCCATTCGGCTTGTTCGAGTAGCTCCGCATGCCATTCGGCTTAAAGAAT
GCTCCTCAGATTTATCAGTGCTTACTGGACAATGCACTCTACGGCTACCTGAAGCTCACACCGAAGCACTTGCAAGATGACGAAGCCGATGTGTTCGTCG
ACGGCAAGGCGGCTGGGACGGATGTGCGACCAGCGATCGGGAGACGCTCCTACATTGACGACATTCTTTTCGGCGGCTCAACGTGGGATGAGATGTGTGA
GCGCCTCGAACGACTGATGGATGCGTGCGAAGAATGGGGTCTCTCTATTAGTCTGCCTAAAAGCCAATTCGGGATGAGTCGCGTCGAGTACCTGGGTCAC
GCTGTATCGGCTCGAGGAGTCGAGGCCACGCCAAAGAACTTGGAGGCGCTGACACAGATCGCCTTTCCGAAGACCGTCAAGGCCGTGCAGTCCTTCCTGG
GGTCGCTCAACTACTACCACCAGTTCGTAGAACACTTCGCGGTGTACGCGGCGTCACTGTACGAGATCTCGCAAGCGGATCTGGCGAAGGAAGCGTCGGA
GCCTGGTCACCTCAAGGCAGCTCGAGTCGCGCTCGACGAGTTGAAGCGCAAGATCGGAGCAACACCGGTCCTGAGGCACTTCGAGCCTGAACGTGAAGCG
ATCCTCGTCGTCTACGCGAATGACTGGGCCGTGGCGAGTACACTTGTGCAAGAGACCGAGGGTCAACTCAAGCCGGTGAAGTTCTACAGCCGCGTCCTCA
AGGCGCACGAGATGAAGCTGTCGCCTGCCGAGAAGGAGATCCTTGCGGCGCTGCAAGCAACTCGCGAGTATAACGCGGCCGCCGACTGTCACAGGGAAGG
CGCTGCAACGCGGACGTGGTGAGGTGGTGACGGCGGACGAGCATCACAGCTTGGCGACGCTGAATCAACTGCAAGAAGTACTGCGCGGACCGAGCGTGCA
GTGTGCGACGTCGGTGGTCGGCGTCACGACTCGAAGTGGGCGACGAACAGGAGATGCCGAAACTCTGCCCGGACGAAATGCGACTCTTCACGGGACTGGT
GTAGCGACACCACGTCTCGGTGAATGTGTGCAAGACGACCCATCTCCGCTCACGACATCGCCTGATGACCGTGTGAGCGACAGGCGGTCTGGTCTGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGTGCCAGAGACGGTCCATCCGATGAATCCAGTGATGTGCGTTTAAGCGACCCCCAGCGTCACGCGTCGA
ATGGTGACGCGAACATAGACGGTCCAGACCATTCAAATCTGACTGTTGAGGCGATGGGACGAGGTAACGACGAAGTGCAACCCGATCGATCGAGGGACAC
CAACGCAAGAAGACGTCATTCAGCGCGTGCGAGCAGAGAGGATCGAACGTGCACAAGAAGAAGAAACATGGATCAAGACGCTGAAGCGGTATCTACGCGG
GGAGGAAGACGTAATTGGAGGTGAGCGCGCCGCCACTCTCGCTAAGGCGGCAGAAGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAT
CGTCGATGGTTTGCTCTTCTATGTGGGTCAGCGCAAGCAACGAGGAGAAGCGAGCCAATAAGCGTGTTTACGGCTTGTCGTTCCTACCACGTTGCATGAG
GAGATCTTGCATCACTACCATGTGAGCTTGGCCGGTGGCCACCAGGGAATCACGCGCACCTACGATCGCGTCCGCAAGGCGCTGTACTGGCGTGGTCAGT
ATCAAGATGTGCGCGACTATGTGCAAGCATGCTCNNNNNNNNNNGCCAGTCCGGAAAGGGGGCACAGTGTCTAACGGGCACCACACCAGGCAACATCAAG
GCGACGAGACCGTTCCAGGTGATCGGCATGGATCACGTGCCTTCGCTTCCACGGTCGCATCGCGGAAACTCGGAACTGCTCGTGTGGGTAGACCTGCATA
CCGGTTTCGCTGTTGTGTCCGCCAACAAGTCGCGTGAGGCACAAGAGGCTGCTGAGTCGTATGAACGGTCGGTGTATAGGCGCTTTGGTGCGAGCGAGGT
GGTCTGACACGACCGTGAGCCTGCATTCATGTCCGCAGTGTTCAGAGCGTTCAATCATCTCATCGGTCAACGAAGCAAGGCGACACTCGCCTACCGGCCA
GTCAAATGGTACTACCGAGCGAATGGTGCAAACAGTGATGCGTGCAGTGAAGCTTTATGTCGCCGACCCCGCTCAACGCGATTGGGACGACTACGCAGAA
CGACTCGTCTTCGCTCTCAACTCGTCTGTGGATCCAGTACGAGGCGATACTCCATTCTACTTGCTCCACGGTTGGGAACCGCGCACTTCGCTTGAGGTTG
CCATGCCGGCGGCAAGTGATCCAACAGGCCACTCACAATCACGAAGGTGGCGAGCGAATGTGCAAGACCAGTATCTTAAGGCGAGGCAGGAGGCGAACGC
GCTACTGGAACAAGCGATGGAGGCGCGGCGTGAGCAGGCGAACGCGAACGAGCAAGGAGATGCTAGCGAGATCGTGCCGGGAGGCAAGGTGTGGGTGTTC
ATCAACCAGGTGAAACCCGGGTATGCGAAGAAGCTGGCACACCTATGGCACGGGCCATTCCGCGTACTGAGTCGCTTGGCTGAGCACGTCGTCCGCCTCG
AGATCGCCGATACCGGCTACCAGTTTTTCCCGCTCGTCCACATCTCCCGCCTCAAATTGTGGCGAGACTACGAGCCGCGCCCGCAAGTGGAACTGGANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCGCAGACCGTCTTGATTTAGACGAAGAGTTGCTTCCCGAAGACTCGTTTGAGCCGGACCACGA
CCAAGGCGAATACGAGGTCGAGGAGATCCTGAAACATGTTGACGAGCGGACTGCGAGGAAGGGGCGCTTTGTGCGTAAGTACCTCGTCCGCTGGGTGGGG
TGCGACGAGCCAAGTTGGGTCGAAGAAGGCGATCTACACGCACCAAGTCTCCTTGAGGAGTATGAGAAGCGATCAAGAGCCCATGGCAGATTCGCTGTCA
TGGATGTGAAGGAAGA