Description :
From Genome Similarity Track
Location :
contig_87:2122- 3480
Sequence
1358 bases(100 bases per row)
GCTGATAATCATCTCCCTGATCGGCTCGTTGAGAGTCATTCAATTCGCCGAGTTTTGGAGCTGTTGTGCCCGAGGGTATCGGATATTCTTCCTTCTCGCC
GTACTTTAGGCAAATGTGTTCTACAATACCATGCTAATCGGTGCAAGGATTTGGATAAAGAAGCGCTCAACTCTGTGGTGACAACAACAGAGGGCTGGAT
CAACCTACTTTCAGACGCGTGGATGAATATTTGTAAGGAACACTTGCTAGGCTGCCAGCTTTCGCTTTTGGAGTTTTACTCACATACGCGCTACTACCCG
CTGGAGATGAATATCATGGAGTAACAATTGCCAAGCAGCTCGAACAACTACTGGAGCAAGTTCAGCAAGTGCAGTGACGCGTTGGAGCAATCGTCATTGA
TAACGCAAGGCAATCTGCACGCACTCGTCGAATATTGACAATTCACTGGTCGCACATAGTTTTTCTTTTTTGTTTCGCCCACGATGTCAATAACTTTGTC
AAGGCTGTATTGCGACCTTCGTTTAAAGTTGTGACAGCCCGAGCGTCAACAGCAGTCAAAAATGTGAACATTTCGTCTAGTGAATGGCTATGGCGAGCAC
GCCAAATGAAGAAGAAATGCTACGAAAACAACTTGGCACTACAAATCTGTGAATCGAGAGGGAACTCGATGCAAGGCTGTTTCCCATCTTTGTTGCGCGT
ACAGTCAGTATTGCAAATGTTCTACCGCCGGTACAAGAGATACGAAGAATTTCCACTGCATTTACGAGCTTTTTGGTGATCCCTGTTTTGGGATGAGTCA
AGGAAGCGGAAGCCGTTATCATACCACTGGCTTACGCATCGTACAGGCTACAGAAAGACGAGAATACGGTTGGAGATGTCGTACTTTCATTTCGCGACAT
TCACAATGGATTTCAGCAACATATCACTTGTCGTGATACACTGGTGGGTTGTATCGAGTCTCGTTGGGCACAGTGCGAGCAACCGTTTTCATGCTGGGTT
TGCGCTGCATCCTTTGTACGCCGAAATCGCGAGGAAAATGCCCCATACTTCCGTGTCTGGTATTGGTGTGCTGTGCAAGATTGCGGTTAACAACTACCGC
CGGCTGTTCGCTACAGAGGGTATCGGCCAGATACGGCGTGATATGTTAGCTTGGATGAAAGGACACTTTACGCGAACGAAACCGAGTGAGTTCATTGGTG
CTACCTGAGAATACTGGGAGAGTGTTGCAGCCGAACGACCACAGAGCTTCCTCCCGAAACTCGCCGTGAGAGTGCTCTCAATTGCTGTAAATACGGCCAC
GTGTGAGCGATGTTTTAGTGACCTTGGATCAATCCACACACCAAAGCGCAATCAAATG