Description :
From Genome Similarity Track
Location :
contig_29:212175- 213999
Transcript NameFunction/comments
g7102.t1XP_009519712.1 hypothetical protein PHYSODRAFT_480010 [Phytophthora sojae

Sequence
1824 bases(100 bases per row)
GTACATCTTCTGCAGGATCGGATTCGCCACGCCCTCCAGCTCCTTCTGCTTCGACTCGTACTCCTCCTTCTCAGCGGACTGGTTGGCGTCGAGCCAGTGG
ATGGTCTCGTCACCTTGTCGTCCACCACCTTCTTGTCGGCCTCCGGGATCTGCTCCTTCAGCTTCTCGTCGTTCAGGCTGTTGCGCAGACTGTACGCGTA
GTTCTCGAGCGCGTTCTTGGCCTCGATGCGCACCTTGTTGGCCTCGTCCTCCGACTTGTACTTCTCGGCCTCCGCCACCATGCGGTCGATATCGGACTGC
GACAGTCGGCCCTTGTCGTTCGTGATGGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGACACGTTCAGGATCCCGTTCGCGTCGATGTCGA
ACGTCACATCAATCTGGGGAACACCACGAGGCATGGGCGGGATGGCGTCCAGGTTGAACTTGCCCAGAAGATGATTGTCACGGGTCATCGAGCGCTCGCC
CTCGAACACCTGGATGAGCACACCAGGCTGGTTGTCCGCGTACGTCGAGAACGTCTGCGCCTTCTTGGTAGGCACCGTCGTGTTACGCGCGATCAGCGTC
GTCATGACACCGCCTGCCGTCTCCAGGCCCAGAGACAGCGGCGTCACGTCCAACAGAACAGGTCGCAGCTTGTCCGACGAGTCGTTGCCGCCCAGGATGG
CCGCCTGTACCGTGCGCCGTACGCTACGGCCTCGTCCGGGTTGATGGACTTGTTGGGCTCCTTGCCGTTGAAGACTCAGACAGCAGTTGCTGCACCTTCG
GGATACGCGTCGAGCCGCCCACTAGCACCACCTCGTTCACCTGGCTCTTGGACAGCTTGCGTCGCGCACACCTTCTCCACGGCTCCATGGTCTTTCGGAT
AGTCGCCGCACAGGTCCTCGAAACGGGCGCGCGTGATGGTCGAGTTGAAGTCCACGCCGTCACAGCGAGTCGATTTCAATGTAGGCCTGGGCGACGACGA
CAGCGTCCGCTTGGCGCGCTCGCACGCCGTACGCAGACGCCGCAGCGCGCGTTGGTTCTGTGCCATGTCCTTGCGGTGTTTGCGCTTGAACTCCTGCACG
AAGAACTCGACGAGGCGGTTGTCGAAGTCCTCGCCGCCCAGGTGCGTGTCGCCAGCGGTGGCCTTCACCTCGAAGATGCCCTCCTCAATGGACAGCAGCG
ACACATCGAAGGTGCCGCCGCCCAGGTCGAAGATCAGCACGTTGCGCTCGCCGCCCTTCTTGTCCAGGCCGTACGCAATAGCGGCGGCCGTGGGCTCGTT
GATGATACGCAGCACGTTCAGCCCGGCGATGGCACCGGCGTCCTTGGTGGCCTGGCGCTGCGAGTCGTTGAAGTAGGCCGGTACCGTGATGACGGCGTTC
TTGACCTCCTTGCCGATGAAGGCCTCGGCCACCTCGCGCATCTTGATAAGCACCATGGACGAGATCTCCTCGGGTTGGAACGTCTTGGACTCGCCCTTGA
ACTGCACCGTGATCTGCGGCTTGTCGCCGGCGCCCGACGTCAGCTTGAACGGCCAGTGCTTGATGTCGGCCTGCACGATCGGGTCCGAGAACTTGCGGCC
GATAAGGCGCTTGGCGTCGAACACCGTGTTGTGCGCGTTCATGGCCACCTGGTTCTTGGCGGCATCACCGATCAGGCGCTCCGTGTCCGTGAAGGCCACG
TAGGACGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATCTCCACGCGGTCGTTCTGCCACACGCCCACGCACGAGTAGGTCGTGCCGAGGTCGATGC
CGACCGAGTATCCAGACGTCTTCG